SimpleSearch - Line and FST details


Line specific information

 
Line ID 578C07
Vector Used pAC161
Line Availability only available from NASC (N455423)
Segregation Analysis 50:47:45
Confirmed for Hit At4g34870
Parent of DUPLO pair none
Parent of pair(s) 5446, 5450, 5563, 11348, 75754, 75757

Gene hit At4g34870

 
Sequence (A. th genome BLAST matches underlined)
>51-K021293-022-578-C07-8409
CCATTTAATGAGTCTCAGCGGTACTCCCATCGGACGGATCGAGATGGAGCTTTTCGCTGA
TACAACCCCAAACACGGCGGAGAATTTCCGTGCTCTCTGTACCGGCGAGAAAGGAATGGG
AAAGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX653262 [GenBank]
Graphic View Graphic view of gene At4g34870
Predicted Position of Insertion Chr4:16614478 - go to primer design
BLAST e Value 1e-61
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation rotamase cyclophilin 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03