Sequences from confirmation amplicon


Confirmation sequences for line 579F07 and hit At4g22950 are shown.
Line ID 579F07
Locus At4g22950 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12024659
Primers used for PCR SZ07 - 8474, show primer details
   
Sequence Name 09-K022051-022-579-F07C-8409
GenBank Accession LN489988 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K022051-022-579-F07C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATAAAACCATTCAAA
AATAAAGAACGCATGCATGCATGATTAGCGAGACCATGCAAACCATTCAATTGTTAACGG
TATTGCATATATAATAATAACTAAAAATGATGAATTTTTTTTTGCTAAATGAATTGAATC
TAGGTTTTAACTATATCTTTTAATTACTTGTGTAGATCACTAGATTAGTATGGTAAAATT
ATTTTTGTAAACGCAAAGAGCCAAACACATGTATAATAACTTCCATCATATTAAGTAAAC
ATAAAATTTTCTCATCAAATCTTAATATTCTAAAATTGCGGAAAAACGATTATAGTATCT
TAATCCTAATTTCCATTATCACTGGAAATGAGTATAAATAATACCTTCTTGGCTCTTATC
CTGCTCAAGCTTCGGTCCAACTG
   
Sequence Name 10-K022051-022-579-F07C-SZ07
GenBank Accession LN490462 [GenBank]
Sequencing primer gene specific primer, SZ07: 5'-AGTTAGAGAATCAGTTGGACCGAA-3'
Sequence (A. th genome BLAST matches underlined)
>10-K022051-022-579-F07C-SZ07
CTTGAGCAGGATAAGAGCCAAGAAGGTATTATTTATACTCATTTCCAGTGATAATGGAAA
TTAGGATTAAGATACTATAATCGTTTTTCCGCAATTTTAGAATATTAAGATTTGATGAGA
AAATTTTATGTTTACTTAATATGATGGAAGTTATTATACATGTGTTTGGCTCTTTGCGTT
TACAAAAATAATTTTACCATACTAATCTAGTGATCTACACAAGTAATTAAAAGATATAGT
TAAAACCTAGATTCAATTCATTTAGCAAAAAAAAATTCATCATTTTTAGTTATTATTATA
TATGCAATACCGTTAACAATTGAATGGTTTGCATGGTCTCGCTAATCATGCATGCATGCG
TTCTTTATTTTTGAATGGTTTTATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAA
ATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCT

Last Updated on 23.10.2014 13:25