SimpleSearch - Line and FST details


Line specific information

 
Line ID 579F07
Vector Used pGABI1
Line Availability only available from NASC (N455555)
Segregation Analysis 100:89:72
Confirmed for Hit At4g22950
Parent of DUPLO pair none
Parent of pair(s) 4517, 4656, 10007, 31497, 78957, 78958

Gene hit At4g22950

 
Sequence (A. th genome BLAST matches underlined)
>54-K021289-022-579-F07-8409
ATTGNATATATAATAATAACTAAAAATGATGAATTTTTTTTTGCTAAATGAATTGAATCT
CGGTTTTAACTATATCTTTTAATTACTTGTGTAAATCAGTAGATTAGTATGGTAAAATTA
TTTTTGTAAACGCAAAGAGACAAACACATGTATAATAACTTCCATCATATTAAGTAAACA
TAAAATTTTCTCATCAAATCTTAATATTCTAAAATTGCGGAAAAACGATTATAGTATCTT
AATCCTAATTTCCATTATCACTGGAAATGAGTATAAATAATACCTTCTTGGCTCTTATCC
TGCTCAAGCTTCGGTCCAACTGATTCTCTAACTGTTGCAGCTCCTCGATGGAACATGCAT
CAATGCCTTCTCCAAGCAATTTTCTGCAATTATTCAACAATCAAAGTATCTTATAGTTCG
TTTATAATTT
GenBank Accession BX653407 [GenBank]
Graphic View Graphic view of gene At4g22950
Predicted Position of Insertion Chr4:12024654 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7H19
Hit Gene Code At4g22950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 19
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03