Sequences from confirmation amplicon


Confirmation sequences for line 585E09 and hit At3g21970 are shown.
Line ID 585E09
Locus At3g21970 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7743062
Primers used for PCR NG24 - 8474, show primer details
   
Sequence Name 29-K102364-0022-585-E09C-8409
GenBank Accession LN499229 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K102364-0022-585-E09C-8409
GCATTTACAATTGAATATATCCTGTCATATATAGGCGACCATATTGAGGATCATACTATA
TATATTCATACCATTAGTATTGAATATGACAACAATATGGTACGACCAATGTCTTTTGGA
GATTTCTTCGGTGGATTCCGAGGGGAGGATCCATTACAAACGTATGTTCTATATGCAAAA
CCCGACGAACGTCACCAACGATCCCAAACGGTTCGAAGATAAAAGAAGGGATCTCCTCCA
CAAGCTAATGCTGGAAGCCACCAAGGATAGCAAGGAAAACGGCGCCAAGGGACTGTTGTA
CGCAGTGGGTGAGATGAGGATTGGAAGAAATAAGATGTATGCAATGGTGCAGTGTACGCA
AGACTTATGGCAGACTGGTTGCCATGTGTGTCTAGAATGGATTACGCAGATGAAATATGG
AGAGTTCTTCTACCGTAAACCAGGAGGGAGAGTTTGTGGTAGGAGTTGTAGCTTTAGGTA
TGAGCTTTACCCTTTTCTTAGAAGGTAAATGACTTTTTTCTTTCTATTTAGTCTGAGCTC
CTATTCTCTC
   
Sequence Name 29-K102365-0022-585-E09C-NG24
GenBank Accession LN499230 [GenBank]
Sequencing primer gene specific primer, NG24: 5'-GGAGAGAAATGGAGCTCAGACTAA-3'
Sequence (A. th genome BLAST matches underlined)
>29-K102365-0022-585-E09C-NG24
TTCTAGAAAGGGTAAAGCTCATACCTAAAGCTACAACTCCTACCACAAACTCTCCCTCCT
GGTTTACGGTAGAAGAACTCTCCATATTTCATCTGCGTAATCCATTCTAGACACACATGG
CAACCAGTCTGCCATAAGTCTTGCGTACACTGCACCATTGCATACATCTTATTTCTTCCA
ATCCTCATCTCACCCACTGCGTACAACAGTCCCTTGGCGCCGTTTTCCTTGCTATCCTTG
GTGGCTTCCAGCATTAGCTTGTGGAGGAGATCCCTTCTTTTATCTTCGAACCGTTTGGGA
TCGTTGGTGACGTTCGTCGGGTTTTGCATATAGAACATACGTTTGTAATGGATCCTCCCC
TCGGAATCCACCGAAGAAATCTCCAAAAGACATTGGTCGTACCATATTGTTGTCATATTC
AATACTAATGGTATGAATATATATAGTATGATCCTCAATATGGTCGCCTATATATGACAG
GATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTA
TGATAGTCAATA

Last Updated on 23.10.2014 13:25