SimpleSearch - Line and FST details


Line specific information

 
Line ID 585E09
Vector Used pAC161
Line Availability only available from NASC (N456121)
Segregation Analysis 50:45:32
Confirmed for Hit At3g21970
Parent of DUPLO pair none
Parent of pair(s) 85909, 85915, 85968, 85979, 85998, 86013

Gene hit At3g21970

 
Sequence (A. th genome BLAST matches underlined)
>69-K021757-022-585-E09-8409
TCATAAATGAAAACATCTCTACCGGAACCTACCCTATAGTGAGACAATATGGTACGACCA
ATGTCTTTTGGAGATTTCTTCGGTGGATTCCGAGGGGAGGATCCATTACAAACGTATGTT
CTATATGCAAAACCCGACGAACGTCACCAACGATCCCAAACGGTTCGAAGATAAAAGAAG
GGATCTCCTCCACAAGCTAATGCTGGAAGCCACCAAGGATAGCAAGGAAAACGGCGCCAA
GGGACTGTTGTACGCAGTGGGTGAGATGAGGATTGGAAGAAATAAGATGTATGCAATGGT
GCAGTGTACGCAAGACTTATGGCAGACTGGTTGCCATGTGTGTCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX654974 [GenBank]
Graphic View Graphic view of gene At3g21970
Predicted Position of Insertion Chr3:7743001 - go to primer design
BLAST e Value 7e-171
Hit Clone Code (BAC ID) MZN24
Hit Gene Code At3g21970 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Domain of unknown function (DUF26)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23