Sequences from confirmation amplicon


Confirmation sequences for line 588D04 and hit At5g09520 are shown.
Line ID 588D04
Locus At5g09520 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:2958978
Primers used for PCR NG21 - 8474, show primer details
   
Sequence Name 12-K102362-0022-588-D04C-8409
GenBank Accession LN491519 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K102362-0022-588-D04C-8409
GCCATTTACATTGATGTCTTCTTCCACAAGACACATTTAAATAGACATTTCAATCAAAGA
TCAAAGCTCATCACAAAAACAAAGAACAACACCACAAAGCAAAGAAAGAAAGAAAGATAA
AAAGCTTGCAAGGAAACAATGACATTGAAGAAGAGTTTCTCTGCTTCTCTACTTTCACCA
TTTCTGATCATATGTCTTATTGCATTGCTTTCTGTTCCGGTATCCGTTGGAGCTCGCCGG
TTATTGGAGGAACCTAAACCAGAGATACCGACATTTCCGGAGCTACCTAAACCAGAGATG
CCAAAGTTACCCGAATTTCCGAAGCTAGAGTTGCCTAAGTTACCTGAGATTCCAAAACCA
GAGATGCCTAAGTTACCGGAGATTCAGAAGCCTGAATTGCCGACGTTTCCAGAGTTACCG
AAGATGCCGGAATTTCCCAAGTTCGATTTTCCAAAGTTGCCGGAATTGCCAAAACCAGAA
GAAACCAAAGTGCCGGCGTTTACAATGCCAAAGTTTCCTGGATCTCCTTAAGCCCATTAC
ACCAGAAGAAGGCCCATCTACTTTGGAGCCCATTCTAATTTACTGAAATTGTC

Last Updated on 07.07.2016 14:16