SimpleSearch - Line and FST details


Line specific information

 
Line ID 588D04
Vector Used pGABI1
Line Availability only available from NASC (N456392)
Segregation Analysis 50:49:40
Confirmed for Hit At5g09520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g09520

 
Sequence (A. th genome BLAST matches underlined)
>28-K021380-022-588-D04-8409
AGCCATTTACATTGATGTCTTCTTCCCAAGACACATTTAAATAGACATTTCAATCAAAGA
TCAAAGCTCATCACAAAAACAAAGAACAACACCACAAAGCAAAGAAAGAAAGAAAGATAA
AAAGCTTGCAAGGAAACAATGACATTGAAGAAGAGTTTCTCTGCTTCTCTACTTTCACCA
TTTCTGATCATATGTCTTATTGCATTGCTTTCTGTTCCGGTATCCGTTGGAGCTCGCCGG
TTATTGGAGGAACCTAAACCAGAGATACCGACATTTCCGGAGCTACCTAAACCAGAGATG
CCAAAGTTACCCGAATTTCCGAAGCTAGAGTTGCCTAAGTTACCTGAGATTCCAAAACCA
GAGATGCCTAAGTTACCGGAGATTCAGAAGCCTGAATTGCCGACGTTTCCAGAGTTACCG
AAGATGCCGGAATTTCCCAAGTTCGATTTTCCAAAGTTGCCGGAATTGCCAAAACCAGAA
GAAACCAAAGTGCCGGCGTTTACAATGCCAAAGTTTCCTGGATCTCCTTAAGCCCATTAC
GenBank Accession BX655285 [GenBank]
Graphic View Graphic view of gene At5g09520
Predicted Position of Insertion Chr5:2958958 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5E8
Hit Gene Code At5g09520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxyproline-rich glycoprotein family protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23