Sequences from confirmation amplicon


Confirmation sequences for line 591D07 and hit At2g16595 are shown.
Line ID 591D07
Locus At2g16595 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:7199394
Primers used for PCR NG18 - 8474, show primer details
   
Sequence Name 15-K102362-0022-591-D07C-8409
GenBank Accession LN492918 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K102362-0022-591-D07C-8409
ATGATTCGACAAATGACCAAATAATAAGTAGCAAACTTAAAGAGCAAAGGCCAGAAAAGG
AAAAGAGGAGAAAACTCTATATTCAGCAAAAGCCATTGTAAGATTCTATATCTAGAAATG
AAATGGAATATAGCTAGAGCCAAAGCAAGTATCTGGTATCAAAACATAAATGATAAAGAT
TAAAGGCTAGAGAGAGACTTTCTTGCATTTAGATACAGGGATGTAACAAGTTCAGGTATT
GTTACTAAACCATGAATGACCTAACAAAGAGTGCATAGTGTGGAGTAACATGAGATGAGA
CAAAACAGGCAATGAAAAGAACCTAACAAAGGGAAAAACTAATATGGAAAGACAAGTGAG
ATCACACAAGCAATAAATGTGAGAAGAAGCAAAAGATGATTAATTACCAGAGCAGTGAGA
TTCTGAACAGCATTTTGATCAAAAGGAAGA

Last Updated on 07.07.2016 14:16