SimpleSearch - Line and FST details


Line specific information

 
Line ID 591D07
Vector Used pAC161
Line Availability only available from NASC (N456683)
Segregation Analysis 50:44:36
Confirmed for Hit At2g16595
Parent of DUPLO pair none
Parent of pair(s) 12415

Gene hit At2g16595

 
Sequence (A. th genome BLAST matches underlined)
>52-K021766-022-591-D07-8409
ATGACCTTATACGTATTTATCTTACCTTAAGAGCACAGGCCCGAAAAGGAAAACATGAGA
AAACTCTATATTCAACAAAAGCCATTGTACCATTCTATATCTAGAAATGAAATGGAATAT
AGCTATGGGATCCTCCCTATAGTGAGACCTATTACTCCCCCCTTTATAGGAAATTGGGAA
TCCCCTGTTTTATCTCCCATATTAAATTCTTTGGGATACTAATTTTATCTCCTTTTTGGG
ATTCTACGTAATTTGGGGAAT
GenBank Accession BX653746 [GenBank]
Graphic View Graphic view of gene At2g16595
Predicted Position of Insertion Chr2:7199371 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) F1P15
Hit Gene Code At2g16595 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Translocon-associated protein (TRAP), alpha subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR812757 [GenBank]


Last Updated on 14.10.2014 10:23