Sequences from confirmation amplicon


Confirmation sequences for line 595C04 and hit At4g14716 are shown.
Line ID 595C04
Locus At4g14716 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:8430848
Primers used for PCR NR57 - 8474, show primer details
   
Sequence Name 80-K102506-0022-595-C04C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>80-K102506-0022-595-C04C-8409
TGATATCGACCGTCTACCCAGATGAACGCACCC
   
Sequence Name 80-K102507-0022-595-C04C-NR57
GenBank Accession LN513936 [GenBank]
Sequencing primer gene specific primer, NR57: 5'-CACATGTAATGTTTGTGTGCAGAG-3'
Sequence (A. th genome BLAST matches underlined)
>80-K102507-0022-595-C04C-NR57
GATACTATGAACCGATGAGGATTTGAAAAAGATCCGTGAATCTCGTGGTTACTCTTACAT
GGTTTGTGGTCTTTATTTATTTACTATCCCACTAGACTTGAATGGTAGATGTTTATTTTT
GTCCAAGTCTTATTTTAACTCTCTAGGGGTTTTCTCAATCTTGGTTTGATGATTAAAAAG
TGTTCAAAATGCAGGACTTTTGTGAGGTATGCCCGGAAAAGCTTCCAAACTATGAAGTGA
AAGTGAAGAGCTTTTTCGAAGAACATTTACACACTGATGAGGAGATCCGTTACTGCGTTG
CAGGAACTGGTAAGAACTTCTTTTACTGGCGGCTTTACTCGTAAACTTAAAATTTCGATA
TAGTAGTCATGTTTTATTTTCTTGGGAAAAAGGTTACTTTGATGTGAGAGATCGTAATGA
AGCTTGGATTAGGGTATTGGTAAAGAAGGGAGGTATGATGGTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16