SimpleSearch - Line and FST details


Line specific information

 
Line ID 595C04
Vector Used pAC161
Line Availability only available from NASC (N457052)
Segregation Analysis 50:43:31
Confirmed for Hit At4g14716
Parent of DUPLO pair none
Parent of pair(s) 63013, 94496, 94497

Gene hit At4g14716

 
Sequence (A. th genome BLAST matches underlined)
>27-K021862-022-595-C04-8409
GNAGCCATTTACATTGAATATATCCTATGGGATCCTCACTATAGTGAGATCCAAGCTTCA
TTACGATCTCTCACATCAAAGTAACCCTTTTTCCCAAGAAAATAAAACATGACTACTATA
TCGAAATTTTAAGTTTACGAGTAAAGCCGCCAGTAAAAGAAGTTCTTACCAGTTCCTGCA
ACGCAGTAACGGATCTCCTCATCAGTGTGTAAATGTTCTTCGAAAAAGCTCTTCACTTTC
ACTTCATAGTTTGGAAGCTTTTCCGGGCATACCTCACAAAAGTCCTGCATTTTGAACACT
TTTTAATCATCAAACCAAGATTGAGAAAACCCCTATGGGATCCTCCCTATAGTGAGACNT
ATTACTCN
GenBank Accession BX654115 [GenBank]
Graphic View Graphic view of gene At4g14716
Predicted Position of Insertion Chr4:8430868 - go to primer design
BLAST e Value 1e-156
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14716 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acireductone dioxygenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR812832 [GenBank]


Last Updated on 07.07.2016 14:03