Sequences from confirmation amplicon


Confirmation sequences for line 603C08 and hit At3g26210 are shown.
Line ID 603C08
Locus At3g26210 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:9594187
Primers used for PCR JZ05 - 8474, show primer details
   
Sequence Name 47-K026770-022-603-C08C-8409
GenBank Accession LN506076 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>47-K026770-022-603-C08C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATAAATGTAGAAAAAGAAAGAGTA
ATTACCAATTTTTTTTATGCATACTAATCAATTCATTCCACCTAGGTCAACGACGGATTA
AAGATTATTTAGAAATGCTTACAGAGATGATTCCTTTGATATGATCAGTAGTGAGCTTAA
AAGAACCATCTTGGCTTTGTTTATTCATCATATCAATCATCACATCCACAACATCTGGAG
TCTCTAATACTTTTCTTCCTGGCTTTAGATGATCATCGAGCACTTGGTTAAAGAATCCGT
CGAGATCAGCAAAAATTTCGTTAAGGCTCTTGCTTTGACCGGTGATTTTATCAAGAATCC
AACCTCCGGGGAAGAAGTTAGAGAAAGCGAATTTCGCCTGAATCTTCTCCGACCTAGAAG
CTAAATCCTCCATGCTATCTTCATCTATAAACTCGGATTCGTGAAGATTTTGACCGAAAG
CGAGTCTACACACGATACTAG
   
Sequence Name 48-K026770-022-603-C08C-JZ05
GenBank Accession LN506395 [GenBank]
Sequencing primer gene specific primer, JZ05: 5'-CACTCTAAGCGCTAGTATCGTGTG-3'
Sequence (A. th genome BLAST matches underlined)
>48-K026770-022-603-C08C-JZ05
TCGCTTTCGGTCAAAATCTTCACGAATCCGAGTTTATAGATGAAGATAGCATGGAGGATT
TAGCTTCTAGGTCGGAGAAGATTCAGGCGAAATTCGCTTTCTCTAACTTCTTCCCCGGAG
GTTGGATTCTTGATAAAATCACCGGTCAAAGCAAGAGCCTTAACGAAATTTTTGCTGATC
TCGACGGATTCTTTAACCAAGTGCTCGATGATCATCTAAAGCCAGGAAGAAAAGTATTAG
AGACTCCAGATGTTGTGGATGTGATGATTGATATGATGAATAAACAAAGCCAAGATGGTT
CTTTTAAGCTCACTACTGATCATATCAAAGGAATCATCTCTGTAAGCATTTCTAAATAAT
CTTTAATCCGTCGTTGACCTAGGTGGAATGAATTGATTAGTATGCATAAAAAAAATTGGT
AATTACTCTTTCTTTTTCTACATTTATATTCAATTGTAAATGGCTTCATGTCCGGGAAAT
CTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCA
ATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATT
TTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTAT
TCTAATTCGGAAATCTTTATTTCGACGTGTCT
Primers used for PCR JZ04 - 8474, show primer details
   
Sequence Name 49-K026771-022-603-C08C-8409
GenBank Accession LN506709 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K026771-022-603-C08C-8409
TAGATTTCCCGGACATGAAGCCATTTACTCTTTCTTTTTCTCCATAAATAAATTGGACAA
ATCAAATTTAAGAATTTATGACATTTTAAAGGTAATCGATTAGGTCAGTAACAACAAATT
GATGGTGAGTTAAAAACTTAGAAATTAGAATCTTATATTTTCATAATTTTTCTCATATTT
TTCACTAAGAGAATTAATATTCTTTAAAACATTCCTTAATTATTTATATAACATTAATTA
ATTCTTTTTTCCTTATATGGCATGTGTATTAAAATTTTATCTTTTTTGCGATTGAATTTA
GGATATATTTCTAGCCGGAGTAAACACAAGTGCAACGACCATTCTTTGGGCAATGACAGA
GTTAATAAGAAACCCAAGAGTGATGAAGAAAGTGCAAGATG
   
Sequence Name 50-K026771-022-603-C08C-JZ04
GenBank Accession LN507049 [GenBank]
Sequencing primer gene specific primer, JZ04: 5'-GTCCTAACCTCATCTTGCACTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>50-K026771-022-603-C08C-JZ04
CACTCTTGGGTTTCTTATTAACTCTGTCATTGCCCAAAGAATGGTCGTTGCACTTGTGTT
TACTCCGGCTAGAAATATATCCTAAATTCAATCGCAAAAAAGATAAAATTTTAATACACA
TGCCATATAAGGAAAAAAGAATTAATTAATGTTATATAAATAATTAAGGAATGTTTTAAA
GAATATTAATTCTCTTAGTGAAAAATATGAGAAAAATTATGAAAATATAAGATTCTAATT
TCTAAGTTTTTAACTCACCATCAATTTGTTGTTACTGACCTAATCGATTACCTTTAAAAT
GTCATAAATTCTTAAATTTGATTTGTCCAATTTATTTATGGAGAAAAAGAAAGAGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTAT
TATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCG
AAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16