SimpleSearch - Line and FST details


Line specific information

 
Line ID 603C08
Vector Used pAC161
Line Availability only available from NASC (N457824)
Segregation Analysis 50:36:26
Confirmed for Hit At3g26210
Parent of DUPLO pair none
Parent of pair(s) 6425, 7820, 7822, 8872, 10636, 10642, 10653, 11052, 11054, 71089, 71176, 71212, 71253, 71336, 71416, 71525, 71593, 71628, 71750, 71779, 71808, 71836, 71860, 71885, 71910, 72008, 72060, 72076, 72090, 72117, 72156, 72174, 72177, 72180

Gene hit At3g26210

 
Sequence (A. th genome BLAST matches underlined)
>59-K023860-022-603-C08-8409
TTGAATATAAATGTAGAAAAAGAAAGAGTAATTACCAATTTTTTTTATGCATACTAATCA
ATTCATTCCACCTATGGGATCCTCCCTATAGTGAGTCGTATGTCTCCCCCCTTTGGCCGG
GCTTGGTGACCCCCGGGGTTTCCCGCCCTGGGGAGCCTGGGGGTTTTCCTCTTCTGGGCA
CTCCTTGGGGCCGGGGGGGCCGTGGGTTAATTCTTTTTCCCTTCNACGGCATGTGTATTG
ACATTTGGGCATATTTGCGGCTGAGATGCGGGTATTCCCCCCTGTGTTGGGGCGCCCCGT
GCGAGCCGCTGCCCCGCTTGTGGGTGCCCCCCCGNNNGGGGGGACCCCCGTTTCCTCCTC
AGATTGGGCTGAGATTATGCGAAAATATACGCTCATATACATAACTACTGACAGTTTGAG
CTACCAATTCCGTGTAGCCCA
GenBank Accession BX892502 [GenBank]
Graphic View Graphic view of gene At3g26210
Predicted Position of Insertion Chr3:9594219 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) MTC11
Hit Gene Code At3g26210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 71, subfamily B, polypeptide 23
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX892502 [GenBank]


Last Updated on 31.08.2016 09:40