Sequences from confirmation amplicon


Confirmation sequences for line 622E02 and hit At1g04600 are shown.
Line ID 622E02
Locus At1g04600 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:1262583
Primers used for PCR AS30 - 8474, show primer details
   
Sequence Name 05-K024728-022-622-E02C-8409
GenBank Accession LN488191 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K024728-022-622-E02C-8409
TCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCTGGATAGATGGAGGATCTCA
TGTCTGGGTGGAGGATCCAGATGATGCCTGGATAGATGGGGAAGTAGAAGAAGTTAACAG
TGAAGAAATCACAGTTAACTGCTCTGGAAAGACGGTAAGAAAGTATAAAACTTGTTAGAT
AATCTGCCGAAGGAGTATATGATTTCTTGATATGGAGACATTTGTTATTGTGGAAAACGT
TTAGCTTTTGATCTTCTGAGTTCTGTGACCATGGAACTAGTTCCTTAATGGTCATGCATT
ATCTGAGATTTGTTTATGACATGAGCATTGAGAAAAAAAGCTCTCGTTTCTGATGCATTT
GTTTCTTAGGTTG
   
Sequence Name 06-K024728-022-622-E02C-AS30
GenBank Accession LN488641 [GenBank]
Sequencing primer gene specific primer, AS30: 5'-ACAACCTAAGAAACAAATGCATCA-3'
Sequence (A. th genome BLAST matches underlined)
>06-K024728-022-622-E02C-AS30
GCTTTTTCTCATCAATGCTCATGTCATAAACAAATCTCAGATAATGCATGACCATTAAGG
AACTAGTTCCATGGTCACAGAACTCAGAAGATCAAAAGCTAAACGTTTTCCACAATAACA
AATGTCTCCATATCAAGAAATCATATACTCCTTCGGCAGATTATCTAACAAGTTTTATAC
TTTCTTACCGTCTTTCCAGAGCAGTTAACTGTGATTTCTTCACTGTTAACTTCTTCTACT
TCCCCATCTATCCAGGCATCATCTGGATCCTCCACCCAGACATGAGATCCTCCATCTATC
CAGACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCA
ATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTC
AAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAA
ATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATC
TTTATTTCGACGTGTCTACATTCACG

Last Updated on 23.10.2014 13:25