SimpleSearch - Line and FST details


Line specific information

 
Line ID 622E02
Vector Used pAC161
Line Availability only available from NASC (N459666)
Segregation Analysis 50:50:35
Confirmed for Hit At1g04600
Parent of DUPLO pair none
Parent of pair(s) 2748, 83584, 83597, 83606, 83610, 83614, 83617, 83619, 83621, 83622

Gene hit At1g04600

 
Sequence (A. th genome BLAST matches underlined)
>13-K021997-022-622-E02-8409
NNNCCGAGCTATTCGGACATGACCATTTACAATTGAATATATCCTGTCTGGATAGATGGA
GGATCTCATGTCTGGGTGGAGGATCCAGATGATGCCTGGATAGATGGGGAAGTAGAAGAA
GTTAACAGTGAAGAAATCACAGTTAACTGCTCTGGAAAGACGGTAAGAAAGTATAAAACT
TGTTAGATAATCTGCCGAAGGAGTATATGATTTCTTGATATGGAGACATTTGTTATTGTG
GAAAACGTTTAGCTTTTGATCTTCTGAGTTCTGTGACCATGGAACTATGGGATCCTCCCT
ATAGTGAGTCGTAATACTCACGGAACTAAACGAATTGGGTACGCACAAGTTTAAAACAAC
AAGAAAAAATACTATACGAGAGACCAAAAAACTTAAATTCAGCAAGCATAATAATACAGT
AGATGTAATGAGAATAAAAAACGCCAAACAAAGATTAACAGAAAAATAGTAACAAGTTGC
ACGATGATCGCGTTTATAATAGAATACAAGGAGAAGGTCTACAAGAATGCAACTAAAGGT
ATCTAAAAAACAAATA
GenBank Accession BX657088 [GenBank]
Graphic View Graphic view of gene At1g04600
Predicted Position of Insertion Chr1:1262578 - go to primer design
BLAST e Value 1e-123
Hit Clone Code (BAC ID) T1G11
Hit Gene Code At1g04600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myosin XI A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23