Sequences from confirmation amplicon


Confirmation sequences for line 651C05 and hit At4g34650 are shown.
Line ID 651C05
Locus At4g34650 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16543917
Primers used for PCR RE56 - 8474, show primer details
   
Sequence Name 15-K026864-022-651-C05C-8409
GenBank Accession LN492816 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K026864-022-651-C05C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAAATATTGGTGGATTTCAAACAATCTTCAAC
ATGATTCAATGCATTAGTGACCATTTCATTCAAACACTGCACTGCTTTTGTAGCTTTCTC
CTCATTTTTGAAGTCCTACATTATTAGAAAGAGTCACATTTGTTTTTTATAATATAAGAT
CTTCAGATGAGAGCTTGAGAGTGAAGTTTATGTACCTCAAGTTTGTCAACATATTTTCCC
CAAATCTCACGAGGCCAAAACATGCGCGACTTTGGTCTCTCATTAATGTCTTCAAGATAA
TCTTTGATAATGTTTGTTTTCTAGCAAATAAGATATAACATACAAAAGACTTCAAAGATT
GCAAAAAACATTTGAGGAAGAAACCTTGTACATGTCAATATTATACCATTGTAATGAATA
CCTGCAGAAATAAACCTGTAGAATTTGAAATCTGCTTCCAATCTGGAGTCAGTATTTCTA
ATTCCG
   
Sequence Name 16-K026864-022-651-C05C-RE56
GenBank Accession LN493284 [GenBank]
Sequencing primer gene specific primer, RE56: 5'-CTTCATTGCTTCGGAATTAGAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>16-K026864-022-651-C05C-RE56
CTGACTCCAGATTGGAAGCAGATTTCAAATTCTACAGGTTTATTTCTGCAGGTATTCATT
ACAATGGTATAATATTGACATGTACAAGGTTTCTTCCTCAAATGTTTTTTGCAATCTTTG
AAGTCTTTTGTATGTTATATCTTATTTGCTAGAAAACAAACATTATCAAAGATTATCTTG
AAGACATTAATGAGAGACCAAAGTCGCGCATGTTTTGGCCTCGTGAGATTTGGGGAAAAT
ATGTTGACAAACTTGAGGTACATAAACTTCACTCTCAAGCTCTCATCTGAAGATCTTATA
TTATAAAAAACAAATGTGACTCTTTCTAATAATGTAGGACTTCAAAAATGAGGAGAAAGC
TACAAAAGCAGTGCAGTGTTTGAATGAAATGGTCACTAATGCATTGAATCATGTTGAAGA
TTGTTTGAAATCCACCAATATTTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGA
CAAATTAC

Last Updated on 23.10.2014 13:25