SimpleSearch - Line and FST details


Line specific information

 
Line ID 651C05
Vector Used pAC161
Line Availability only available from NASC (N462429)
Segregation Analysis 50:43:24
Confirmed for Hit At4g34650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g34650

 
Sequence (A. th genome BLAST matches underlined)
>35-K021264-022-651-C05-8409
TGACCATTTCATTCAAACACTGCACTGGCTTCCGTAGCTTTCTCCTCATTTTTGAAGTCC
TACATTATTAGAAAGAGTCACATTTGTTTTTTATAATATAAGATCTTCAGATGAGAGCTT
GAGAGTGAAGTTTATGTACCTCAAGTTTGTCAACATATTTTCCCCAAATCTCACGAGGCC
AAAACATGCGCGACTTTGGTCTCTCATTAATGTCTTCAAGATAATCTTTGATAATGTTTG
TTTTCTATGGGATCCTCCCTATAGTGAGANNAANNNATNNNNNNTNNTAANNTTTTTTTT
NNATTTNTAANTTTNAATNAAAATTTTTTTTNAAAAAAAACTGAGGGTACTTTTGATAAG
GGGCAAATTAGAATCCGTCGTATTTAGAGGCGAAAGCAATAAACAAATTATTCGAATTCG
GAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTAAGATGAGAAT
GenBank Accession BX660191 [GenBank]
Graphic View Graphic view of gene At4g34650
Predicted Position of Insertion Chr4:16543914 - go to primer design
BLAST e Value 7e-128
Hit Clone Code (BAC ID) T4L20
Hit Gene Code At4g34650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation squalene synthase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX660191 [GenBank]


Last Updated on 31.08.2016 09:40