Sequences from confirmation amplicon


Confirmation sequences for line 661H05 and hit At5g14640 are shown.
Line ID 661H05
Locus At5g14640 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:4720474
Primers used for PCR JC09 - 8474, show primer details
   
Sequence Name 55-K026771-022-661-H05C-8409
GenBank Accession LN508688 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K026771-022-661-H05C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAAGTTCTGGTATAGCATTTGTAAAGA
GACATGTTGATTTGTTTTCATATGGTGCTATGCAATGTTAACTAGTCCTAACTATTTTAG
CTTTGCCCCTCTGTAACAGGTTAAAGGCGAGCCAAACATCTCATACATCTGCTCCCGTTA
CTATCGAGCACCTGAACTTATATTTGGAGCTACAGAATATACAACAACAATTGACATATG
GTCTGCAGGCTGTGTTCTTGCTGAATTGCTTCTGGGACAGGTAATATGACTGTCCAAACT
TTCCTCCATTTATCTTTTACAAATGATTTGATTTACCGAATGATGTCTAAAGTTATATAT
TACCAATCTTTGGCTTGTCCAACTTTTGGTTAGCCTCTATTTCCAGGT
   
Sequence Name 56-K026771-022-661-H05C-JC09
GenBank Accession LN508987 [GenBank]
Sequencing primer gene specific primer, JC09: 5'-ACTCCACTCTCACCTGGAAATAGA-3'
Sequence (A. th genome BLAST matches underlined)
>56-K026771-022-661-H05C-JC09
CTAACCAAAAGTTGGACAAGCCAAAGATTGGTAATATATAACTTTAGACATCATTCGGTA
AATCAAATCATTTGTAAAAGATAAATGGAGGAAAGTTTGGACAGTCATATTACCTGTCCC
AGAAGCAATTCAGCAAGAACACAGCCTGCAGACCATATGTCAATTGTTGTTGTATATTCT
GTAGCTCCAAATATAAGTTCAGGTGCTCGATAGTAACGGGAGCAGATGTATGAGATGTTT
GGCTCGCCTTTAACCTGTTACAGAGGGGCAAAGCTAAAATAGTTAGGACTAGTTAACATT
GCATAGCACCATATGAAAACAAATCAACATGTCTCTTTACAAATGCTATACCAGAACTTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACATTC

Last Updated on 07.07.2016 14:16