SimpleSearch - Line and FST details


Line specific information

 
Line ID 661H05
Vector Used pAC161
Line Availability only available from NASC (N463449)
Segregation Analysis 50:47:35
Confirmed for Hit At5g14640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g14640

 
Sequence (A. th genome BLAST matches underlined)
>40-K023861-022-661-H05-8409
AATTGAAGTTCTGGTATAGCATTTGTAAAGAGACATGTTGATTTGTTTTCATATGGTGCT
ATGCAATGTTAACTATGCCCACCTCCCTATANTGAGCCCCACTGTACAAGGTTATANGCT
ATCCTTACATCTCATACCTCTGCTCCCGTTACTACCGAGCTTCTGAACTCATATTTGGAG
CTACCGAATGATGGGAGGGGGAGGTGCCTAATGGCTCTGCATCACTACTCTTATTCCTAA
AATAGCTTCTGTGCACCACTTAATCTGACAGAGCAATATAACCTCATAACCTCGAAGATA
TAACAACTATAATAACTAACACACCAATCTAAACAAACAGATTATACCCATCAAAACCCA
ATAATTAACAAAAACTTAAGACCTCCCCCACCAATATACACGAAAAATCTAAACAAACCC
CTAAATAAATCCAAACCCCAATTAAAATATTCAAATACAAATCAAAACATAACAACAAAT
ACTGTAAACACACAAACAACCAAACACACCTACCCAAACAACCATACTACACAATCACAC
ACAATCAAATCTACTAACTTAAACAAAACTAATTAAT
GenBank Accession BX894139 [GenBank]
Graphic View Graphic view of gene At5g14640
Predicted Position of Insertion Chr5:4720541 - go to primer design
BLAST e Value 3e-19
Hit Clone Code (BAC ID) T15N1
Hit Gene Code At5g14640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation shaggy-like kinase 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23