Sequences from confirmation amplicon


Confirmation sequences for line 673B11 and hit At5g39390 are shown.
Line ID 673B11
Locus At5g39390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:15763912
Primers used for PCR MA69 - 8474, show primer details
   
Sequence Name 71-K102435-0022-673-B11C-8409
GenBank Accession LN512532 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>71-K102435-0022-673-B11C-8409
GCCTTTACATTGAATTATCCTGACATCTCCCGGCTACCAAAGTCGGTATTGTCGTGTTCC
ACGAGCAGAGGAGGCAGAACCATGGTTGATGAGTGGTTGAGACTAGTTTTGGAAGTGGGA
ATAAAGTGTTCTGAAGAATATCCACGGGATAGGATGGGAATGGCTGAAGCGGTACGAGAA
TTAGTCTCAATCAAATCTAAGTTCTTTACTTCCTCTCGATGATCTTCAAAGTTCTCCTCA
CAAATGGACATTAAACAGGAAGATGCATATAATCTAGACTAAGATGATGATATCATAGTC
ACCTATCTACTACTTATGGGGATACATTGAATGTGTCTTTACGTCTGCTTCATGGTAAGA
GAGAGACTACAAGGATGATAATCTTACTTATGATGTTAATAATTTTTCATGCCTTAGAAA
GAAGCTGTTCAACTTTTTATATATATGATTTTAGGGCATAAATGGGTTGTTGTGATATTC
CTTTTCTTTCGGCTCAAGTTATGTGATTGCTTCAAGTTTGGTCTCCAATGAGATACCGTG
GTTCTAT
   
Sequence Name 71-K102436-0022-673-B11C-MA69
GenBank Accession LN512533 [GenBank]
Sequencing primer gene specific primer, MA69: 5'-AATAGAACCACGGTATCTCATTGG-3'
Sequence (A. th genome BLAST matches underlined)
>71-K102436-0022-673-B11C-MA69
CTTGAGCCGAAAGAAAGGAATATACAACAACCCATTTATGCCCTAAAATCATATATATAA
AAAGTTGAACAGCTTCTTTCTAAGGCATGAAAAATTATTAACATCATAAGTAAGATTATC
ATCCTTGTAGTCTCTCTCTTACCATGAAGCAGACGTAAAGACACATTCAATGTATCCCCA
TAAGTAGTAGATAGGTGACTATGATATCATCATCTTAGTCTAGATTATATGCATCTTCCT
GTTTAATGTCCATTTGTGAGGAGAACTTTGAAGATCATCGAGAGGAAGTAAAGAACTTAG
ATTTGATTGAGACTAATTCTCGTACCGCTTCAGCCATTCCCATCCTATCCCGTGGATATT
CTTCAGAACACTTTATTCCCACTTCCAAAACTAGTCTCAACCACTCATCAACCATGGTTC
TGCCTCCTCTGCTCGTGGAACACGACAATACCGACTTTGTGTAGCCGTGGAGATGTCAGG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTC
GACGTGTCTACATTCACTCCCAAAATGGG

Last Updated on 07.07.2016 14:16