SimpleSearch - Line and FST details


Line specific information

 
Line ID 673B11
Vector Used pAC161
Line Availability only available from NASC (N464535)
Segregation Analysis 50:50:44
Confirmed for Hit At5g39390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39390

 
Sequence (A. th genome BLAST matches underlined)
>82-K022949-022-673-B11-8409
TCCGGACTGAGCCATTTACATTGAATATATCCTGACATCTCCACGGCTACACAAGTCGGT
ATTGTCGTGTTCCACGAGCAGAGGAGGCAGAACCATGGTTGATGAGTGGTTGAGACTAGT
TTTGGAAGTGGGAATAAAGTGTTCTGAAGAATATCCACGGGATAGGATGGGAATGGCTGA
AGCGGTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX661315 [GenBank]
Graphic View Graphic view of gene At5g39390
Predicted Position of Insertion Chr5:15763912 - go to primer design
BLAST e Value 8e-75
Hit Clone Code (BAC ID) MUL8
Hit Gene Code At5g39390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23