Sequences from confirmation amplicon


Confirmation sequences for line 675B02 and hit At4g26840 are shown.
Line ID 675B02
Locus At4g26840 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13498352
Primers used for PCR AB13 - 8474, show primer details
   
Sequence Name 11-K024846-022-675-B02C-8409
GenBank Accession LN490943 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K024846-022-675-B02C-8409
TGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATAAACTATAAACTATAAACTT
CAAAAAGGTAAGAAATAAAGCATGTAGAATGAATGTTATACCTCATCGGGAGTTTGCTCA
GCACGAAGACGACGCCCATCAAACAAGAAAGCAATGGAGTTCATGTCCACAGATTGCCGG
TCACAGTAAGCATTCATCAGCTTCTTGAGCTGAGTGCTTCTCTTGATCCTAAAGAAAACC
TCGTTTCCATCCTATAAAACAAACATATAGAAGGAACAATAAACGTTAGAGACCGCATAT
GAAACAATAACTAAATCACATGGCTCTCTTTTGGTAGTAACCTGAAAGAGTCGAAAAATT
AAACACATATCAACAAACATTCAGTTTAAGGCTTCGTCTATGAGAATTTGAAGCACAAAC
ATCAGCCAAACTAATTGAAAACTTAGTACAGAGACTACAACTTCATCAGAAGATATATAA
CAACTTAGTACAGAGACAGCATCGTTCACAGTCTTTAGAACATTCAACAACTAAGTAAAC
TTATCCCTTCCAAAACTATAAAACCCTC
   
Sequence Name 12-K024846-022-675-B02C-AB13
GenBank Accession LN491403 [GenBank]
Sequencing primer gene specific primer, AB13: 5'-CCTGTTGTTGTTTGAGGGTTTTAT-3'
Sequence (A. th genome BLAST matches underlined)
>12-K024846-022-675-B02C-AB13
ATTTTGGACAGGATAAGTTTACTTAGTTGTTGAATGTTCTAAAGACTGTGAACGATGCTG
TCTCTGTACTAAGTTGTTATATATCTTCTGATGAAGTTGTAGTCTCTGTACTAAGTTTTC
AATTAGTTTGGCTGATGTTTGTGCTTCAAATTCTCATAGACGAAGCCTTAAACTGAATGT
TTGTTGATATGTGTTTAATTTTTCGACTCTTTCAGGTTACTACCAAAAGAGAGCCATGTG
ATTTAGTTATTGTTTCATATGCGGTCTCTAACGTTTATTGTTCCTTCTATATGTTTGTTT
TATAGGATGGAAACGAGGTTTTCTTTAGGATCAAGAGAAGCACTCAGCTCAAGAAGCTGA
TGAATGCTTACTGTGACCGGCAATCTGTGGACATGAACTCCATTGCTTTCTTGTTTGATG
GGCGTCGTCTTCGTGCTGAGCAAACTCCCGATGAGGTATAACATTCATTCTACATGCTTT
ATTTCTTACCTTTTTGAAGTTTATAGTTTATAGTTTATATTCAATTGTAAATGGCTTCAT
GTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAG
AGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAAT
GAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAAT
AAACAAATTATTCTAATTCGGAAATCT

Last Updated on 07.07.2016 14:16