SimpleSearch - Line and FST details


Line specific information

 
Line ID 675B02
Vector Used pAC161
Line Availability only available from NASC (N464718)
Segregation Analysis 50:49:38
Confirmed for Hit At4g26840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g26840

 
Sequence (A. th genome BLAST matches underlined)
>10-K022994-022-675-B02-8409
TCCGGAATGAACCATTTACATTGAATATAAACTATAAACTATAAACTTCAAAAAGGTACC
AAATAAAGCATGTAGAATGAATGTTATACCTCATCGGGAGTTTGCTCAGCACGAAGACGA
CGCCCATCAAACAAGAAAGCAATGGAGTTCATGTCCACAGATTGCCGGTCACAGTAAGCA
TTCATCAGCTTCTTGAGCTGAGTGCTTCTCTTGATCCTAAAGAAAACCTCGTTTCCATCC
TATAAAACAAACATATAGAAGGAACAATAAACGTTAGAGACCGCATATGAAACAATAACT
AAATCACATGGCTCTCTTTTGGTAGTAACCTGAAAGAGTCGAAAAATTAAACACATATCA
ACAAACATTCAGTTTAAGGCTTCGTCTATGAGAATTTGAAGCACAAACATCAGCCAAACT
AATTGAAAACTTAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX661397 [GenBank]
Graphic View Graphic view of gene At4g26840
Predicted Position of Insertion Chr4:13498352 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10M23
Hit Gene Code At4g26840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation small ubiquitin-like modifier 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40