Sequences from confirmation amplicon


Confirmation sequences for line 687D04 and hit At1g08160 are shown.
Line ID 687D04
Locus At1g08160 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:2559773
Primers used for PCR NG81 - 8474, show primer details
   
Sequence Name 28-K102364-0022-687-D04C-8409
GenBank Accession LN498786 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K102364-0022-687-D04C-8409
GCCATTTACAATCGACCGGAAAATCCCGTCTTGTAGCTCACTCTAGCCGTTATATACACT
TCCATTTCGATCGTCCCTTTTGATTTTTCAGCCCTTAAGTCCCTGGCATTGAACTTAGAC
AGTGCCACATTGTGGGACACAAGCTGCGTCTCAATCCTAGTCTCGTTCTTAGGACGTTGC
TTGAAAGGAGAGATATTTTTGTGAGCCACGGACTGGTTATGATGAGCCGTGGAGATACGC
ATGGAGTGGTATCTTACGGAGACATGTTTCTCCGGGTTGTATGATTTGATCACGTAGCTG
AATTTTGCGTTGATGTGATCGTCATTGTTGCCTATAGCAAACTCTTGGACCGACGCGGCT
TCTACCGTGTAGATGAGTCGCTTTGGCCTGAGTGTGAGGTATGTGATCAATATGGCGAGA
CCCACGAGGAGTCCCAAGAGGACGAGGGCGACGATGATGCATAGGACGGGGTTCATACGC
CTGCCCGGCAGGGGTTGTGCTCGAGGTTGCGATTGGGGTTGCAGTTGCGGTTGCGTTCGC
CGAGCCGGTTGGTGGGCTGGGTTTGGAGGCACCATTGTCAGAGAAGGTTTTGATGGACTT
CAGTTAATTGCTTGGAAAGGATA
   
Sequence Name 28-K102365-0022-687-D04C-NG81
GenBank Accession LN498787 [GenBank]
Sequencing primer gene specific primer, NG81: 5'-TCTTTGCTCTCTATCCTTTCCAAG-3'
Sequence (A. th genome BLAST matches underlined)
>28-K102365-0022-687-D04C-NG81
CATGGTGCCTCCAACCCAGCCACCAACCGGCTCGGCGAACGCAACCGCAACTGCAACCCC
AATCGCAACCTCGAGCACAACCCCTGCCGGGCAGGCGTATGAACCCCGTCCTATGCATCA
TCGTCGCCCTCGTCCTCTTGGGACTCCTCGTGGGTCTCGCCATATTGATCACATACCTCA
CACTCAGGCCAAAGCGACTCATCTACACGGTAGAAGCCGCGTCGGTCCAAGAGTTTGCTA
TAGGCAACAATGACGATCACATCAACGCAAAATTCAGCTACGTGATCAAATCATACAACC
CGGAGAAACATGTCTCCGTAAGATACCACTCCATGCGTATCTCCACGGCTCATCATAACC
AGTCCGTGGCTCACAAAAATATCTCTCCTTTCAAGCAACGTCCTAAGAACGAGACTAGGA
TTGAGACGCAGCTTGTGTCCCACAATGTGGCACTGTCTAAGTTCAATGCCAGGGACTTAA
GGGCTGAAAAATCAAAAGGGACGATCGAAATGGAAGTGTATATAACGGCTAGAGTGAGCT
ACAAGACGTGGATTTTCCGGTCGATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCG
GAAATCTTTATTTCGACGTGTCTACAT

Last Updated on 23.10.2014 13:25