SimpleSearch - Line and FST details


Line specific information

 
Line ID 687D04
Vector Used pAC161
Line Availability only available from NASC (N465896)
Segregation Analysis 50:50:48
Confirmed for Hit At1g08160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08160

 
Sequence (A. th genome BLAST matches underlined)
>28-K023113-022-687-D04-8409
AAAATCCACGATCTTGTAGCTCACGTCTATGCGATACTCCCTATAGCGTGTCGATCGTCC
CTTTTGATTTTTCANCCCTTAANTCCCTGTCATTNAACTTATACACTNACACATTCCATC
ACATTCTCTCTTATTATTTACTATCAACAATTCAATATTACACTTCCTATACCTCAACAT
TTATCATCCACCCTCTTACTTTCAACTCATCTATCTCCCACAACTTCTTTATATCTCAAA
CCAATCATTCACAATCCTAACTCACCAACCCTTATACTCCTCTCACCCCCCCCAAGACAC
CCATTTCATCTTCAAATTGCCCTGACATTATGCGAAACATTACACTCATATCCATAAATA
CTGAGCGTCCCGAGCTCCCAAACGCATCGGCGACTCCTGCGGGGACCCACCCCTAGATAC
CCATTTCGTCTTCAGATTGGGCTGAGCATGAGGCGACAATATACCCTCGTAT
GenBank Accession BX662250 [GenBank]
Graphic View Graphic view of gene At1g08160
Predicted Position of Insertion Chr1:2559791 - go to primer design
BLAST e Value 1e-12
Hit Clone Code (BAC ID) T6D22
Hit Gene Code At1g08160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662249 [GenBank]


Last Updated on 07.07.2016 14:03