Sequences from confirmation amplicon


Confirmation sequences for line 692F09 and hit At1g55210 are shown.
Line ID 692F09
Locus At1g55210 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:20598461
Primers used for PCR DN07 - 8474, show primer details
   
Sequence Name 15-K101828-0022-692-F09C-8409
GenBank Accession LN492915 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K101828-0022-692-F09C-8409
CATTTACATTGAATTATCCTGCCAATAGACTTTGAAATGGGTAAGTTTCTCCTTTTTGTG
GAGACCAAGAAGTTTCCGGTCCATGGTTCTAGCGAAGTCTTCACCGTCTCCGGCGGAAGA
AACCACGGCGAGAAAGAGGATTTGGACGGCGAGGAAGAAAATGAGCTTAGCCATGTGTTT
TGTTGTGGTTTTGGTTACTATGGTTGGTTTGTTTACATAAGTGGTGTAGAAAACAAGGTG
GTGTGATGCTTTTATATATATGTCAAATTTTAGACATCTTTCTAGAAATTAATTAAAAAA
AAATATCTTGTTTAATTCTGGNATTCGTT
   
Sequence Name 59-K101831-0022-692-F09C-DN07
GenBank Accession LN509956 [GenBank]
Sequencing primer gene specific primer, DN07: 5'-AAACGAATCCACGAATTAAACAAG-3'
Sequence (A. th genome BLAST matches underlined)
>59-K101831-0022-692-F09C-DN07
AATTTGACTATATATAAAAGCATCACACCACCTTGTTTTCTACACCACTTATGTAAACAA
ACCAACCATAGTAACCAAAACCACAACAAAACACATGGCTAAGCTCATTTTCTTCCTCGC
CGTCCAAATCCTCTTTCTCGCCGTGGTTTCTTCCGCCGGAGACGGTGAAGACTTCGCTAG
AACCATGGACCGGAAACTTCTTGGTCTCCACAAAAAGGAGAAACTTACCCATTTCAAAGT
CTATTGGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGC

Last Updated on 07.07.2016 14:16