Sequences from confirmation amplicon


Confirmation sequences for line 695B04 and hit At1g17830 are shown.
Line ID 695B04
Locus At1g17830 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6136779
Primers used for PCR NB60 - 8474, show primer details
   
Sequence Name 15-K034548-022-695-B04C-8409
GenBank Accession LN492877 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K034548-022-695-B04C-8409
TGAAGCCTTTACAATTGGTACCTAAAACAAACCCAAAGAAGGGAGAAAAAATTGTAAGCT
AGTTAGGTTTTTGATGCAAGATGAAGAGAATGAGGTCACAAAATTTGAAATGGATGAGAA
CCTTAGCGGTAAGAGGAACACGCAAGTGCGGTTTAACGGACTCAAAGTACTGAAAATCAA
TAGAACCGAGCTTATCTCGCATCAATGAAGAAGTACCATCGATCTCATAACCCGAATCAT
CAGAAACAGAATCCCATATTTTGCTAGAACCACTGCTCATTGACCTAGACAACTTCTCAA
TCTCACTATCATCACTCCAACATTCACTCTCACAATCAACCACATCACTATGAATCCTGC
AAAAACCAATGATTCACTCCTCAAGTTCCTTGACACTGACACATATATAGAACAACACTC
TTTATATGTAATAGATCAAACCTAGAAATGGCTGTAGATTTGTTAGTATAGATTTGAATG
GCGGATAGATACGGGACATAG
   
Sequence Name 16-K034548-022-695-B04C-NB60
GenBank Accession LN493343 [GenBank]
Sequencing primer gene specific primer, NB60: 5'-ATCCGTTATGCAGTACTATGTCCC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K034548-022-695-B04C-NB60
TCTATCTAACAATCTACAGCCATTTCTAGGTTTGATCTATTACATATAAAGAGTGTTGTT
CTATATATGTGTCAGTGTCAAGGAACTTGAGGAGTGAATCATTGGTTTTTGCAGGATTCA
TAGTGATGTGGTTGATTGTGAGAGTGAATGTTGGAGTGATGATAGTGAGATTGAGAAGTT
GTCTAGGTCAATGAGCAGTGGTTCTAGCAAAATATGGGATTCTGTTTCTGATGATTCGGG
TTATGAGATCGATGGTACTTCTTCATTGATGCGAGATAAGCTCGGTTCTATTGATTTTCA
GTACTTTGAGTCCGTTAAACCGCACTTGCGTGTTCCTCTTACCGCTAAGGTTCTCATCCA
TTTCAAATTTTGTGACCTCATTCTCTTCATCTTGCATCAAAAACCTAACTAGCTTACAAT
TTTTTTCTCCCTTCTTTGGGTTTGTTTTAGGTACCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCCAATGG

Last Updated on 07.07.2016 14:16