SimpleSearch - Line and FST details


Line specific information

 
Line ID 695B04
Vector Used pAC161
Line Availability only available from NASC (N466640)
Segregation Analysis 60:47:46
Confirmed for Hit At1g17830
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g17830

 
Sequence (A. th genome BLAST matches underlined)
>26-K024558-022-695-B04-8409
GAAGATAACTCTGACATGAAGCCATTTACAATTGGATACTAATAAAACCCAAAGAACGGA
GAAAAAAATTGTAAGCTAGTTAGGTTTTTGATGCAAGATGAAGAGAATGAGGTCACAAAA
TTTGAAATGGATGAGAACCTTACCGGTATGAGGAACACGCAAGTGCGGTTTAACGGACTC
ATAGTACTGAAAATCAATAGAACCGAGCTTATCTCGCATCAATGAAGAAGTACCATCGAT
CTCATAACCCGAATCATCAGAAACAGAATCCCATATTTTGCTAGAACCACTGCTCATTGA
CCTATGGGATCCTCCCTATAGTGAGACTACGGACCTCCTCTCTTTAGCGGAATCTACGTC
ACCTCTGTGAATCCAGCAAAAACCAATGAGTGACTCCTCTGATTCCTGGAAGCGTAGCCC
CTCAGAGTATCACATCGCTTGTCGAATGACATGATCACAGCAGAGATATATACGAGCTCA
GAGACGCATCATAATGCTGCATGGGGCATTGACGGCAAGAACACGA
GenBank Accession BX944110 [GenBank]
Graphic View Graphic view of gene At1g17830
Predicted Position of Insertion Chr1:6136796 - go to primer design
BLAST e Value 1e-123
Hit Clone Code (BAC ID) F2H15
Hit Gene Code At1g17830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF789)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K13N2

 
Sequence (A. th genome BLAST matches underlined)
>26-K024553-022-695-B04-8409
GTTTGCAAGTTTTCTTTTGATGTCTATCCATTATAAACCTAGCTATTATACAGTGCGGTG
AACCATATCACATCCTGTGCTATGTTACAGATTATAAGAACACATATATGAATGCACCTG
GAGAGAACTCCACCAAGTGTTGAAGTACAAAGAAGTGACCCTACAACTATGTGTACCGAT
AATGTTGACTCCTTTCTTGACTTATGTATAATAATAATATCTGAAACATTGCGTGATACC
GATGACTACATCTACATGCACACCAAAAACACTTTAACTATGGGATCCTCCCTATAGTGA
GCAACCTTCAAGATGATGCTGCAAAAATCGGAGGAAGAGTTTGGGTTTAGGCAAGAGAGC
GGCCTCACCATTCCTTGTGACCAAAACACCTTTCTCACTCTCTTATACTCAATCACATCT
TACTAGCTATGGAATCCTCCCTATAATGAGTATCTGCAGAGCACCTTATTATCCAGGGT
GenBank Accession BX944109 [GenBank]
Graphic View Graphic view of sequence BX944109 of line 695B04
Predicted Position of Insertion Chr3:9372556 - go to primer design
BLAST e Value 1e-64
Hit Clone Code (BAC ID) K13N2
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03