Sequences from confirmation amplicon


Confirmation sequences for line 697G04 and hit At1g65670 are shown.
Line ID 697G04
Locus At1g65670 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24423672
Primers used for PCR NE14 - 8474, show primer details
   
Sequence Name 72-K102370-0022-697-G04C-8409
GenBank Accession LN512700 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>72-K102370-0022-697-G04C-8409
ATTTACAATTGAAATGGAAAAAATAATAGATATGGACCAATTTTTCGGACAAGTTTATTT
GGAGCCAAAGTTATAATCTCGACGGATATTGAATTAAATATGGAGATAGCAAAGACAAAC
CATGCTCCTGGTCTCACAAAGAGCATAGCACAACTCTTTGGAGAAAACAACTTGTTTTTT
CAGAGCAAGGAGTCTCATAAACATGTCCGAAACTTGACATTCCAGTTGTTAGGTTCACAA
GGTTTGAAATTGAGTGTGATGCAAGACATCGATCTCTTGACTCGCACACACATGGAAGAA
GGAGCTAGGAGAGGTTGTC
   
Sequence Name 72-K102371-0022-697-G04C-NE14
GenBank Accession LN512701 [GenBank]
Sequencing primer gene specific primer, NE14: 5'-AGACAACCTCTCCTAGCTCCTTCT-3'
Sequence (A. th genome BLAST matches underlined)
>72-K102371-0022-697-G04C-NE14
GATGTCTTGCATCCACTCAATTTCAACCTTGTGAACCTAACAACTGGAATGTCAAGTTTC
GGACATGTTTATGAGACTCCTTGCTCTGAAAAAACAAGTTGTTTTCTCCAAAGAGTTGTG
CTATGCTCTTTGTGAGACCAGGAGCATGGTTTGTCTTTGCTATCTCCATATTTAATTCAA
TATCCGTCGAGATTATAACTTTGGCTCCAAATAAACTTGTCCGAAAAATTGGTCCATATC
TATTATTTTTTCCATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGA
CAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAA
ATCTTTATTTCGACGTGTCTACATTCACTCCCAAAATGG

Last Updated on 23.10.2014 13:25