SimpleSearch - Line and FST details


Line specific information

 
Line ID 697G04
Vector Used pAC161
Line Availability only available from NASC (N466892)
Segregation Analysis 50:50:39
Confirmed for Hit At1g65670
Parent of DUPLO pair none
Parent of pair(s) 490, 3320, 83849, 83862, 83877

Gene hit At1g65670

 
Sequence (A. th genome BLAST matches underlined)
>31-K024555-022-697-G04-8409
CCATTTACAATTGAATATGGAAAAATAATAGATATGGACCAATTTTTCGGACAAGTTTAT
TTGGAGCCAAAGTTATAATCTCGACGGATATTGAATTAAATATGGAGATAGCAAAGACAA
ACCATGCTCCTGGTCTCACAAAGAGCATAGCACAACTCTTTGGAGAAAACAACTTGTTTT
TTCAGAGCAAGGAGTCTCATAAACATGTCCGAAACTTGACATTCCAGTTGTTAGGTTCAC
AAGGTTTGAAATTGAGTGTGATGCAAGACATCGATCTCTTGACTCGCACACACATGGAAG
AAGGAGCTATGGGATCCTCCCTATAGTGAGGCGAANTNNTCTTTCTTATTTGGAATATAA
AGAAATCACACATGGCGGGTGGTCCCGGAAGGATAAAACAAAACTTTTTGGAAAAAACTA
GTTGTTTTTACAAATAAGGGATCCCAAAATACTGCCAAAAATTTGA
GenBank Accession BX944411 [GenBank]
Graphic View Graphic view of gene At1g65670
Predicted Position of Insertion Chr1:24423667 - go to primer design
BLAST e Value 2e-162
Hit Clone Code (BAC ID) F1E22
Hit Gene Code At1g65670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 702, subfamily A, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX944412 [GenBank]


Last Updated on 31.08.2016 09:40