Sequences from confirmation amplicon


Confirmation sequences for line 702E12 and hit At1g16190 are shown.
Line ID 702E12
Locus At1g16190 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5543747
Primers used for PCR BG38 - 8474, show primer details
   
Sequence Name 20-K101744-0022-702-E12C-8409
GenBank Accession LN495152 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>20-K101744-0022-702-E12C-8409
GAAAACCCTCCTCGGTAACCTTGTTCTCCACCAAGGTAGTTTCATCTTTCAAAACCTTTC
CATTGTGAATCAGTAATTGCTGCCCACAAGGATAGTTGTCTTTGCTTTGTGAATCTTCAA
TATTCTTCTTCACCGCCATTATCTTCAAAGCAAAGTAGAAAAATTCCAGGATATAACCAT
GTAAGAACTCATAGACAAATACACTCACTCAACCCATCCATTTCATCGGAAAAAAAAAAA
CTCAAAATTCTAAATCTAGCATTTCTAGAAAGCTGTTCAACAAGTCACATGTTTCAAAAC
CCAAATGGGTATAGCAGCATCTCTCATCTTCAAAAAATATCTAAATCTACGGATTTCCTA
ATACAGTATTACACGTAGGTACGGACCAAGGAAGCGGAAAAGGAGAAGGACTAACCGTGT
CGGTGGGAAAAACCCTAATCTCAAAATGGCTACCCTTGAGAGTCTTAACAGTGAGCTTCA
TGTCGACAAAGGAGACTAGAAAATATAACCGGCGGCGTCAGCAAAGTCCGGCAAGGGAGC
GAAAAATAGAGAGTGACCTAAAAGAGCTTTTTGATTTTCAATCACTGTACAACAATGCCA
ACTTTATCAAACAGTC
   
Sequence Name 20-K101750-0022-702-E12C-BG38
GenBank Accession LN495153 [GenBank]
Sequencing primer gene specific primer, BG38: 5'-CTATGTTGTTGACAGCGACTGTTT-3'
Sequence (A. th genome BLAST matches underlined)
>20-K101750-0022-702-E12C-BG38
ATTGAAATCAAAAGCTCTTTTAGGTCACTCTCTATTTTTCGCTCCCTCGCCGGACTTTGC
TGACGCCGCCGGTTATATCTTCTAGTCTCATTCGTCGACATGAAGCTCACTGTTAAGACT
CTCAAGGGTAGCCATTTTGAGATTAGGGTTCTTCCCACCGACACGGTTAGTCCTTCTCCT
TTTCCGCTTCCTTGGTCCGTACCTACGTGTAATACTGTATTAGGAAATCAGTAGATTTAG
ATATCTTCTGAAGATGAGAGATGCTGCTATACCAATCTGGGTTATGAAACATGTGACTTG
TTGAACAGCTTTCTAGAAATGCTAGATTTAGAATTTTGAGTTTTTTTTTTTCCAATAAAA
TGGATGGGTTGAGTGAGTGTATTTGTCTATAAGTTCTTACATGGTTATATCCGGGAATTT
TTCTACTTTGCTTTGAAAATAAGGGCGGTAAAAAAAAATATTGAAAATTCACAAAGCAAA
GACAACTATCCTTGTGGGCAGCATTTACGGATTCACAATGGAAAGGTTTTGAAAGATGAA
ACTACCTTGGTGGAAAACAAGGTTACCGAGGAGGGTTTTCTTGTAAATGGCTTCATGTCC
GGGAAATCTACTTGGATCACCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTA
ATTACCATTTTTTTTTCAATTCAAAAATGTAAATTTC

Last Updated on 07.07.2016 14:16