SimpleSearch - Line and FST details


Line specific information

 
Line ID 702E12
Vector Used pGABI1
Line Availability only available from NASC (N467356)
Segregation Analysis 50:48:37
Confirmed for Hit At1g16190
Parent of DUPLO pair none
Parent of pair(s) 166, 3415, 8222

Gene hit At1g16190

 
Sequence (A. th genome BLAST matches underlined)
>93-K025033-022-702-E12-8409
AGAAACCCTCCTCGGTAACCTTGTTCTCCACCAAGGTAGTTTCATCTTTCAAAACCTTTC
CATTGTGAATCAGTAATTGCTGCCCACAAGGATAGTTGTCTTTGCTTTGTGAATCTTCAA
TATTCTTCTTCACCGCCATTATCTTCAAAGCAAAGTAGAAAAATTCCAGGATATAACCAT
GTAAGAACTCATAGACAAATACACTCACTCAACCCATCCATTTCATCGGAAAAAAAAAAA
CTCAAAATTCTAAATCTAGCATTTCAAAAAAGCTGTTCAACAAGTCACATGTTTCAAAAC
CCAAATTGGTATAGCACCATCTCTCATCTTCAAAAAATATCTAAATCTACGGATTTCCTA
AAACAGAATTACACGTAGGTAGGGGACCCCCCCAAAAGGGA
GenBank Accession BX944785 [GenBank]
Graphic View Graphic view of gene At1g16190
Predicted Position of Insertion Chr1:5543745 - go to primer design
BLAST e Value 1e-172
Hit Clone Code (BAC ID) T24D18
Hit Gene Code At1g16190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Rad23 UV excision repair protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03