Sequences from confirmation amplicon


Confirmation sequences for line 703F03 and hit At1g78260 are shown.
Line ID 703F03
Locus At1g78260 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29448476
Primers used for PCR NE08 - 8474, show primer details
   
Sequence Name 01-K102429w-0022-703-F03C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K102429w-0022-703-F03C-8409
ATTAACGTGCAAGAATGTAATACTAGATGGAAGTTCTTATTTCTATTCTTTTTTAATAAC
ATGTTTTAAATTTTAATAAGTAGAACCGGAATTTGTAAAATTATACACTTTTTTTCTTGA
TAGAGAATCATTCAATTTTTCGTTTTTTCAGGTACACCTATAACCCTGATCAATTTGGGT
ACCACCAAGTAAGTCCCTTTTTCTCTCACTGACATACACATATACGAAAGATGAACATAA
AGCAAAATCGTATTTAATCATGAGTGCAAGATGTGAAATTAATAATAGATTTTACGTACA
ACATATCTTGCACATGTCGACCACTTACATAATGCATGAAAAACACTAGCACATGCATGT
TTGTTGCAAACATAGACATCGACTATGATGATGATGATGATGATCATATACTTGCCACAG
GCATTGTACAACACACAGTTGCAACAAGCACAATACTATCAGCAGCAGCAACAGCTTTAT
GGAGGAGGAGCAACATCACCATCATCATCAGGAGCAACCATCATGCCTTCTCCATACTAT
TATGGCTATTCTCTTCA
   
Sequence Name 17-K102430-0022-703-F03C-NE08
GenBank Accession LN493798 [GenBank]
Sequencing primer gene specific primer, NE08: 5'-CTAGGAGCTTGAAGAGAATAGCCA-3'
Sequence (A. th genome BLAST matches underlined)
>17-K102430-0022-703-F03C-NE08
ATGGTTGCTCCTGATGATGATGGTGATGTTGCTCCTCCTCCATAAAGCTGTTGCTGCTGC
TGATAGTATTGTGCTTGTTGCAACTGTGTGTTGTACAATGCCTGTGGCAAGTATATGATC
ATCATCATCATCATCATAGTCGATGTCTATGTTTGCAACAAACATGCATGTGCTAGTGTT
TTTCATGCATTATGTAAGTGGTCGACATGTGCAAGATATGTTGTACGTAAAATCTATTAT
TAATTTCACATCTTGCACTCATGATTAAATACGATTTTGCTTTATGTTCATCTTTCGTAT
ATGTGTATGTCAGTGAGAGAAAAAGGGACTTACTTGGTGGTACCCAAATTGATCAGGGTT
ATAGGTGTACCTGAAAAAACGAAAAATTGAATGATTCTCTATCAAGAAAAAAAGTGTATA
ATTTTACAAATTCCGGTTCTACTTATTAAAATTTAAAACATGTTATTAAAAAAGAATAGA
AATAAGAACTTCCATCTAGTATTACATTCTTGCACGTTAATGGTTTCTCAACTTCCGTAT
CGGACTATAATGCATTGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATG
AAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATA
AACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACTCCCA

Last Updated on 07.07.2016 14:16