SimpleSearch - Line and FST details


Line specific information

 
Line ID 703F03
Vector Used pGABI1
Line Availability only available from NASC (N467455)
Segregation Analysis 50:40:32
Confirmed for Hit At1g78260
Parent of DUPLO pair 12556
Parent of pair(s) none

Gene hit At1g78260

 
Sequence (A. th genome BLAST matches underlined)
>22-K025034-022-703-F03-8409
CGATACGGAGTTGAGAACCATTAACGTGCAAGAATGTAATACTAGATGGAAGTTCTTATT
TCTATTCTTTTTAATAACATGTTTTAAATTTTAATAAGTAGAACCGGAATTTGTAAAATT
ATACACTTTTTTTCTTGATAGAGAATCATTCAATTTTTCGTTTTTTCAGGTATGGGATCC
TCCCTATAGTGAG
GenBank Accession BX944906 [GenBank]
Graphic View Graphic view of gene At1g78260
Predicted Position of Insertion Chr1:29448455 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F3F9
Hit Gene Code At1g78260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding (RRM/RBD/RNP motifs) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03