Sequences from confirmation amplicon


Confirmation sequences for line 709E08 and hit At5g54095 are shown.
Line ID 709E08
Locus At5g54095 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:21952877
Primers used for PCR NE04 - 8474, show primer details
   
Sequence Name 46-K102431-0022-709-E08C-8409
GenBank Accession LN505824 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>46-K102431-0022-709-E08C-8409
GCCATTTACAATTGAATATATCCTGAGTATGATAGTCATACAAGAGGCTCTTCGTTGGTT
TTGGTGTAATTGGCTGCTACAACAGCCTCCTCTTGTTTTGGTGGCTCAGTCTCCTTAACA
GTTTCGACGACAGCTTCTTCGGTCTTCACCACCTCTGGAGCTGCCTCAGCCTCAGCAGGC
TTGGCTACCTCAGCCTCGGCAGGCTTGGCTACCTCAGCCTCGGCAGGCTTAGCTGCCTCG
GCCTCGGCCGGTTTGGCTGCCTCAGCTTCCTTCGGTGTCTCTGCTACATCTCCAGCAGAC
TCTTCCTTCTTTTCTGTGACAACTTCATCTGCCTTCTCCTGTAAATCAACAAAACAATCA
CACATCTTTCACCTAAAACATAGACAAAATGGATAAAAACCGATCATTCTCTAATGAACT
TGTTCTACAAACCTGAGATACGGTTTCAGTTTCGACGTTCTTGGACTCGACAACAGTCTT
TTCGGTTTCAGGGATATCAGATTCCTTAGGTTTGCTCGCACAGCCTCCCATGGTGTTTAA
TAGAAAGAAATCGGTTTGAAACGAAAACAAATTTACACAATGGGAAGAACTGTGGAGCTA
AAAGATTCTGATTCCTTTCAAGAAGCCAAAACTGTTTGTTTCTTTTTTCTCCTTATTAGA
GGCTGAGCAAATGTAGGTGAAGACACAAAAGAGATATATATAGTGGTTCGTACCAACACA
ACACAACACAAAGC
   
Sequence Name 46-K102432-0022-709-E08C-NE04
GenBank Accession LN505825 [GenBank]
Sequencing primer gene specific primer, NE04: 5'-TTCCTGAAATAGCTTTGTGTTGTG-3'
Sequence (A. th genome BLAST matches underlined)
>46-K102432-0022-709-E08C-NE04
TCTCTTTTGTGTCTTCCCTACATTTGCTCAGCCTCTAATAAGGAGAAAAAAGAAACAAAC
AGTTTTGGCTTCTTGAAAGGAATCAGAATCTTTTAGCTCCACAGTTCTTCCCATTGTGTA
AATTTGTTTTCGTTTCAAACCGATTTCTTTCTATTAAACACCATGGGAGGCTGTGCGAGC
AAACCTAAGGAATCTGATATCCCTGAAACCGAAAAGACTGTTGTCGAGTCCAAGAACGTC
GAAACTGAAACCGTATCTCAGGTTTGTAGAACAAGTTCATTAGAGAATGATCGGTTTTTA
TCCATTTTGTCTATGTTTTAGGTGAAAGATGTGTGATTGTTTTGTTGATTTACAGGAGAA
GGCAGATGAAGTTGTCACAGAAAAGAAGGAAGAGTCTGCTGGAGATGTAGCAGAGACACC
GAAGGAAGCTGAGGCAGCCAAACCGGCCGAGGCCGAGGCAGCTAAGCCTGCCGAGGCTGA
GGTAGCCAAGCCTGCCGAGGCTGAGGTAGCCAAGCCTGCTGAGGCTGAGGCAGCTCCAGA
GGTGGTGAAGACCGAAGAAGCTGTCGTCGAAACTGTTAAGGAGACTGAGCCACCAAAACA
AGAGGAGGCTGTTGTAGCAGCCAATTACACCAAAACCAACGAAGAGCCTCTTGTATGACT
ATCATACTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTTCA
ATTCANAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACG
ACNAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGA
AATCTTTATTTCGACGTGTCTACT

Last Updated on 07.07.2016 14:16