SimpleSearch - Line and FST details


Line specific information

 
Line ID 709E08
Vector Used pGABI1
Line Availability only available from NASC (N468024)
Segregation Analysis 50:49:48
Confirmed for Hit At5g54095
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g54095

 
Sequence (A. th genome BLAST matches underlined)
>61-K022966-022-709-E08-8409
AGGCTCTTCGTAGACCGAGGGGTAAATGGTGTGCTACCTCGGCCGCCTCTTGATCTCTGG
AGGGTAACCCCCCTATAACAGAGTCGACGACAGCTTCTTCGGTCTTCACCACCTCTGGAG
CTGCCTCAGCCTCAGCAGGCTTGGCTACCTCAGCCTCGGCAGGCTTGGCTACCTCAACCT
CGGCAGGCTTAGCTGCCTCGGCCTCGGCCGGTTTGGCTGCCTCACCTTCCTTCGGTGTC
GenBank Accession BX662912 [GenBank]
Graphic View Graphic view of gene At5g54095
Predicted Position of Insertion Chr5:21952875 - go to primer design
BLAST e Value 2e-78
Hit Clone Code (BAC ID) MJP23
Hit Gene Code At5g54095 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03