Sequences from confirmation amplicon


Confirmation sequences for line 710H02 and hit At2g27380 are shown.
Line ID 710H02
Locus At2g27380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11713514
Primers used for PCR NE03 - 8474, show primer details
   
Sequence Name 49-K102433-0022-710-H02C-8409
GenBank Accession LN506792 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K102433-0022-710-H02C-8409
TTACAATTGAATATATCCTGCACATATATCCGCCGCCAATTTATGGTGCCATATCAGTTT
CATTTAGTATGAGACTGATAGTGGTCACGCACATCCGCCACCAATTTATGGTGCCCCACC
CAGCTACACAACACCACCACCACCAATTTACAGTCCTCCCATAAATCCACCACCAATACA
AAAGCCTCCGACTTATAGTCCTCCCATATATCCACCACCAATACAAAAACCTCCCACCCC
AACTTATAGTCCTCCCATATATCCACCACCAATACAAAAGCCCCCGACACCAACTTACAG
TCCTCCCATTAATCCACCACCAATACAAAAGCCTCCGACCCCAACTTATAGTCCTCCCAT
AAATCCACCACCAATACAAAAGCCTCCGACACCAAGTTATAGTCCTCCTATAAAACCACC
TCCGGTACAAATGCCTCCTACAACAACTTATATTCCCCCTATAAAACCACCACCAGTAAA
TAAGCCTCCAACACCAACTTATAGCCCCCCTATAAAACCACCACTGCAAAAACATCCGAC
ACCAATTTATAGTCCTCCAATAAAA
   
Sequence Name 49-K102434-0022-710-H02C-NE03
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, NE03: 5'-GATTGGAGGACTGTAAATTGGTGT-3'
Sequence (A. th genome BLAST matches underlined)
>49-K102434-0022-710-H02C-NE03
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACCAATTACGATCCGTCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACATTCACGTCCAAATGGG

Last Updated on 07.07.2016 14:16