SimpleSearch - Line and FST details


Line specific information

 
Line ID 710H02
Vector Used pGABI1
Line Availability only available from NASC (N468150)
Segregation Analysis 50:50:34
Confirmed for Hit At2g27380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g27380

 
Sequence (A. th genome BLAST matches underlined)
>16-K023050-022-710-H02-8409
AGCCATTTACATTGAATATATCCTGCACATATATCCGCCGCCAATTTATGGTGCCATATC
AGTTTCATTTAGTATGAGACTGATAGTGGTCACGCACATCCGCCACCAATTTATGGTGCC
CCACCCAGCTACACAACACCACCACCACCAATTTACAGTCCTCCCATATATCCACCACCA
ATACAAAAGCCTCCGACTTATAGTCCTCCCATATATCCACCACCAATACAAAAACCTCCC
ACCCCAACTTATAGTCCTCCCATATATCCACCACCAATACAAAAGCCCCCGACACCAACT
TACAGTCCTCCCATTTATCCACCACCAATACAAAAGCCTCCGACCCCAACTTATAGTCCT
CCCATATATCCACCACCAATACAAAAGCCTCCGACACCAAGTTATAGTCCTCCTGTTAAA
CCACCTCCAGTATGGGATCCTCCCTATAGTGAGTATAGTCCCCCTATAAAACCACCACCA
GTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNN
GenBank Accession BX663123 [GenBank]
Graphic View Graphic view of gene At2g27380
Predicted Position of Insertion Chr2:11713479 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F12K2
Hit Gene Code At2g27380 [TAIR] [MIPS] [SIGnAL]
Gene Annotation extensin proline-rich 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23