Sequences from confirmation amplicon


Confirmation sequences for line 713C09 and hit At3g45240 are shown.
Line ID 713C09
Locus At3g45240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:16571144
Primers used for PCR BG49 - 8474, show primer details
   
Sequence Name 16-K101743-0022-713-C09C-8409
GenBank Accession LN493374 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K101743-0022-713-C09C-8409
CATTTACAATTGAATATATCCTGAAATCAGTGGAGCGAGAGAGAAGCGGAACCTTGTCAT
AAGTATCTTGAAGTGTATCACCCAGAAATGGGTATTGTCCTAAAATCATACAATACAAAG
TAACTCCTACTGCCCACGTATCTGCAGATCTTCCACTGTATGTTATACCTAAACAACATT
CTGGGGCAGTAAAGACAGGAGTGCCGGGTGATCTACGGAGTTGATCATCATCATCCTTCA
TCAAATGTATCATGTTTTAGCAGATCAAATTACACATTACAGAGATTAACGGAGAAGAAA
AAGAAGAAAAGAAATGGTATCATCAGTACTTTGAATACTTGGCTGACACTGAAATCTCCT
ATTTTCACTCTCCCGGTACTAGTAACCAGTAAATTGTCAGGTTTGATGTCACCATGAATT
ACATTCTGTTTCATCCAAAAGACAAAGAGAAAATCATGAGTATCTATCATATAAACTTTC
AGTGTGGATGATGAAGTATTATATAATGCAGAGCATACATGAGCATGAAGGTACATGAGG
CCGGCAACTACATCGCGCAAGTACTTTCTAGCAGTAATTTCTCCGAGAGCACCCGGTGGT
CCAGAATCATCATAGGCCCATTTTCCATCAACATATTCGAGAACTATACNAGAAACAACA
CAATATAAGATGACAGACAAAGAGAAAGACTTGAGGTAACGATNTACAAAGCAGAGGGAA
AG
   
Sequence Name 16-K101749-0022-713-C09C-BG49
GenBank Accession LN493375 [GenBank]
Sequencing primer gene specific primer, BG49: 5'-TACATGGGTATTTCTTTCCCTCTG-3'
Sequence (A. th genome BLAST matches underlined)
>16-K101749-0022-713-C09C-BG49
CAGTCTTTCCTTGTCTGTCATCTTATATTGTGTTGTTTCTTGTATAGTTCTCGAATATGT
TGATGGAAAATGGGCCTATGATGATTCTGGACCACCGGGTGCTCTCGGAGAAATTACTGC
TAGAAAGTACTTGCGCGATGTAGTTGCCGGCCTCATGTACCTTCATGCTCATGTATGCTC
TGCATTATATAATACTTCATCATCCACACTGAAAGTTTATATGATAGATACTCATGATTT
TCTCTTTGTCTTTTGGATGAAACAGAATGTAATTCATGGTGACATCAAACCTGACAATTT
ACTGGTTACTAGTACCGGGAGAGTGAAAATAGGAGATTTCAGTGTCAGCCAAGTATTCAA
AGTACTGATGATACCATTTCTTTTCTTCTTTTTCTTCTCCGTTAATCTCTGTAATGTGTA
ATTTGATCTGCTAAAACATGATACATTTGATGAAGGATGATGATGATCAACTCCGTAGAT
CACCCGGCACTCCTGTCTTTACTGCCCCAGAATGTTGTTTAGGTATAACATACAGTGGAA
GATCTGCAGATACGTGGGCAGTAGGAGTTACTTTGTATTGTATGATTTTAGGACAATACC
CATTTCTGGGTGATACACTTCAAGATACTTATGACAAGGTTCCGCTTCTCTCTCGCTCCA
CTGATTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCANAAATGTAG

Last Updated on 07.07.2016 14:16