SimpleSearch - Line and FST details


Line specific information

 
Line ID 713C09
Vector Used pGABI1
Line Availability only available from NASC (N468385)
Segregation Analysis 50:50:47
Confirmed for Hit At3g45240
Parent of DUPLO pair 2361
Parent of pair(s) none

Gene hit At3g45240

 
Sequence (A. th genome BLAST matches underlined)
>67-K022964-022-713-C09-8409
CCATTGAAATATAATATTTTCAGTAATCCAAGTAGCTAGAGATAAATCTATTCTCGTCAT
AACAAACTGGACACGAATCGCCCATAATTGCGGATTGACCCAATCTTCTACCTAACGGAC
TAGATCCTACTGCCCCCGTATCTGCGGATCTTCCACTGTATGTTATACCTAAACAACATT
CTGGGGCAGTAAAGACAGGAGTGCCGGGTGATCTACGGAGTTGATCATCATCATCCTTCA
TCAAATGTATCATGTTTTAGCATATCAGATTACACATTACAGAGATTAACGGAGAAGAAA
AAGAAGAAAAGAAATGGTATCATCACTATGGGATCCTCCCTATAGTGAGCAACTCGACCG
ACGCCGTCC
GenBank Accession BX663416 [GenBank]
Graphic View Graphic view of gene At3g45240
Predicted Position of Insertion Chr3:16571155 - go to primer design
BLAST e Value 9e-81
Hit Clone Code (BAC ID) T14D3
Hit Gene Code At3g45240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation geminivirus rep interacting kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX663417 [GenBank]


Last Updated on 14.10.2014 10:23