Sequences from confirmation amplicon


Confirmation sequences for line 718H06 and hit At1g53190 are shown.
Line ID 718H06
Locus At1g53190 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:19839487
Primers used for PCR NF16 - 8474, show primer details
   
Sequence Name 09-K102427-0022-718-H06C-8409
GenBank Accession LN490121 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K102427-0022-718-H06C-8409
TTACAATTGAATATGAAACCAGATAATAAAAGACAGCAACTTTTAGCTCCTAACTCTGAT
AACTACATCGGTAAAGAGTAATGAAGGGCTCACCTCGTAAGACATTTCCTCGATGTCCAA
TCGCATATCTCGATGATGATCAATGTGATTATTTCCAGAACCACCAAGGAAGTCTCCAAA
CTCCAAAAGCGCAACTTCCTACACACATTGAAAGAGAACCAAAAGAAACAAAACCTTGAG
CAACGACAAAAATGAAAAAAGATGGAGCAGAAAATTTGAGGAAAGAAAGTTACATCATCA
GGCATCACTCTAAGCCGAGGAACTCCTCCACGGTGTTGTCTAAGAGTTGCTACAGGTACA
GAATCATCTCGCTGATGATGCTGGTATATCCGAAACCCGGTTGGTTGAACCGGACCCATG
TGACTCGAGCCCATCTCTGACCCCAAGGGACCACT
   
Sequence Name 09-K102428-0022-718-H06C-NF16
GenBank Accession LN490122 [GenBank]
Sequencing primer gene specific primer, NF16: 5'-GAACACAATGAATAGTGGTCCCTT-3'
Sequence (A. th genome BLAST matches underlined)
>09-K102428-0022-718-H06C-NF16
GGTTCACCAACCGGGTTTCGGATATACCAGCATCATCAGCGAGATGATTCTGTACCTGTA
GCAACTCTTAGACAACACCGTGGAGGAGTTCCTCGGCTTAGAGTGATGCCTGATGATGTA
ACTTTCTTTCCTCAAATTTTCTGCTCCATCTTTTTTCATTTTTGTCGTTGCTCAAGGTTT
TGTTTCTTTTGGTTCTCTTTCAATGTGTGTAGGAAGTTGCGCTTTTGGAGTTTGGAGACT
TCCTTGGTGGTTCTGGAAATAATCACATTGATCATCATCGAGATATGCGATTGGACATCG
AGGAAATGTCTTACGAGGTGAGCCCTTCATTACTCTTTACCGATGTAGTTATCAGAGTTA
GGAGCTAAAAGTTGCTGTCTTTTATTATCTGGTTTCATATTCAATTGTAAATGGCTTCAT
GTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAG
AGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAAT
GAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAAT
AAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16