SimpleSearch - Line and FST details


Line specific information

 
Line ID 718H06
Vector Used pGABI1
Line Availability only available from NASC (N468922)
Segregation Analysis 50:47:41
Confirmed for Hit At1g53190 At1g60800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g53190

 
Sequence (A. th genome BLAST matches underlined)
>48-K025281-022-718-H06-8409
GNAGCCATTTACATTGAATATATCCTGTTATGATTTGAGAGAGCATCCGTTTTGCTTCTG
AGCTCTGATCATGACCCTCGGTCCTGAGTAATGACTGGTTCTCCTCTTAGGAGATTTCCT
CGATGTTCTTTCGCATAGATATATGATGATCAATGAGAGTAGTTCGAGATCCACCAGGGA
GGTCGTCCGACTCCCTCAGGCGCAATTTCCTACACTCTTTGAAAGAGAACCTAAAGAAAC
AAAACCTTGAGCAACGACCAATATGAAAGAAGATGGAGCAGAAAATTTGAGGAAAGAAAG
TTACATCATCAGGCATCACTCTAAGCCGAGGAACTCCTCCACGGTGTTGTCTAAGAGTTG
CTACAGGTATGGGATCCTCCCTATAGTGAGACNNTGTTACNGTCCTTGAGACGTTTGACA
GCCACCAAAGTTCCATCGTTTAAGTGTCCTTTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR357290 [GenBank]
Graphic View Graphic view of gene At1g53190
Predicted Position of Insertion Chr1:19839480 - go to primer design
BLAST e Value 8e-75
Hit Clone Code (BAC ID) F12M16
Hit Gene Code At1g53190 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g60800

 
Sequence (A. th genome BLAST matches underlined)
>48-K025307-022-718-H06-8409
NNNTTCGTCGTATCCGGACATGAGCCTTTACATTGAATATATCCTGTTATCATCTAACAG
AGTACCGGTTTCTTATATGCTCAACACATGACCGAAACCCTATAAGAACCCTAATTCCCT
TATCTGGGAACTACTCACAGATTATTACTCAGAGAGATAGATTTGTAGAGAGAGACTGGT
GATTTCAGCGGGCATGCCCGTATGGGATCCTCCCTATAGTGAGCAGTTTTTTTGGAAACT
GCCTTACCTTTTAAGCGTGATGCGACACTCCCATTTGGCATGTAGAGGTAGACTAAAATT
CGCTCCTGGTTGCTACTACAGAAACCGCCGATCCGGACCAAATAGCTCCGCCGAGCCGTT
GTTATAGACTCGACTTCTGTCTGAGACTGGACTTCTCCACCCGCAATGTTACAGTCCTTG
AGACGTTTGACAGCCACCAAAGTTCCATCGTTTAAGTGTCCTTCGTATGGGATCCTCCCT
ATAGTGAGNNNNNNNNNNNNNN
GenBank Accession CR357291 [GenBank]
Graphic View Graphic view of gene At1g60800
Predicted Position of Insertion Chr1:22384563 - go to primer design
BLAST e Value 8e-75
Hit Clone Code (BAC ID) F8A5
Hit Gene Code At1g60800 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NSP-interacting kinase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23