Sequences from confirmation amplicon


Confirmation sequences for line 726G10 and hit At2g10465 are shown.
Line ID 726G10
Locus At2g10465 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:4032451
Primers used for PCR NF10 - 8474, show primer details
   
Sequence Name 11-K102427-0022-726-G10C-8409
GenBank Accession LN491058 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K102427-0022-726-G10C-8409
ATTTACAGAGAACCAAAGATGGAAGTGATTGAAGAGAATTAGGAGTTTGACCTCGCAGCT
CCTATTCTTATTTAAATTATGTTTCGAACTTCTTTTAATTTTCTCCAAACTTTATCATTT
TAAGTTGTTTTTTTGTTCAAATTTGCTAAGGTATTGAACCTATTTAAGTATTGTATTCCC
GTTTGATTTTTCTCTACCTCACTTTTTGTTAAACTCCTAACAAAGTTTACAAGTATAACA
TAAAAAAATACAAACATACTCCTATATAATTTTGCAACGATTACATAAAAGTATAGTTGT
AGTTTTTTTTTATTTCTGTTAAAATACTATCCTTATGATTTGTTTTTTTAGACATATAAT
TATTGATGATTCTTTTTACATTTTGATAAAAGTTGTTTGGGTACCAAGAATAAAACATTT
AAAACTTTGAGATAAATCATTCTTGGAAACATTAGGATCATTTATTATTAAGTTCATTTC
TTTTCAACTTAATGTCATTGTCTTATACAAAAAAGTAAAAATATATATTTGTTTTGTTTA
TATTTTAAAACCCTGCAAAGCCATTAT
   
Sequence Name 11-K102428-0022-726-G10C-NF10
GenBank Accession LN491059 [GenBank]
Sequencing primer gene specific primer, NF10: 5'-AGATAATGCTTTTGCAGGGTTTTA-3'
Sequence (A. th genome BLAST matches underlined)
>11-K102428-0022-726-G10C-NF10
TATATTTTACTTTTTTGTATAGACAATGACATTAAGTTGAAAAGAAATGAACTTAATAAT
AAATGATCCTAATGTTTCCAAGAATGATTTATCTCAAAGTTTTAAATGTTTTATTCTTGG
TACCCAAACAACTTTTATCAAAATGTAAAAAGAATCATCAATAATTATATGTCTAAAAAA
ACAAATCATAAGGATAGTATTTTAACAGAAATAAAAAAAAACTACAACTATACTTTTATG
TAATCGTTGCAAAATTATATAGGAGTATGTTTGTATTTTTTTATGTTATACTTGTAAACT
TTGTTAGGAGTTTAACAAAAAGTGAGGTAGAGAAAAATCAAACGGGAATACAATACTTAA
ATAGGTTCAATACCTTAGCAAATTTGAACAAAAAAACAACTTAAAATGATAAAGTTTGGA
GAAAATTAAAAGAAGTTCGAAACATAATTTAAATAAGAATAGGAGCTGCGAGGTCAAACT
CCTAATTCTCTTCAATCACTTCCATCTTTGGGTTCTCTTGTAAATGGCTTCATGTCCGGG
AAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25