SimpleSearch - Line and FST details


Line specific information

 
Line ID 726G10
Vector Used pGABI1
Line Availability only available from NASC (N469682)
Segregation Analysis 50:44:33
Confirmed for Hit At2g10465
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g10465

 
Sequence (A. th genome BLAST matches underlined)
>79-K025134-022-726-G10-8409
TCCGGAATGAGCATTTAAAGAGAACCAAAGATGGAAGTGATTGAAGAGAATTAGGAGTTT
GACCTCGCAGCTCCTATTCTTATTTAAATTATGTTTCCAACTTCTTTTAATTTTCTCCAA
ACTTTATCATTTTAAGTTGTTTTTTTGTTCAAATTTGCTAAGGTATTGAACCTATTTAAG
TATTGTATTCCCGTTTGATTTTTCTCTACCTCACTTTTTGTTAAACTCCTAACAAAGTTT
ACAAGTATAACATAAAAAAATACAAACATACTCCTATATAATTTTGCAACGATTACATAA
AAGTATAGTTGTAGTTTTTTTTTATTTCTGTTAAAATACTATCCTTATGATTTGTTTTTT
TAGACATATAATTATTGATGATTCTTTTTACATTTTGATAAAAGTTGTTTGGGTATGGGA
TCCTCCCCATAGTGAGAGCACAAAAACCACTATCCTCCATAAAGCTCTAT
GenBank Accession CR358392 [GenBank]
Graphic View Graphic view of gene At2g10465
Predicted Position of Insertion Chr2:4032459 - go to primer design
BLAST e Value 3e-167
Hit Clone Code (BAC ID) F12P23
Hit Gene Code At2g10465 [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23