Sequences from confirmation amplicon


Confirmation sequences for line 737D05 and hit At2g04032 are shown.
Line ID 737D05
Locus At2g04032 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:1289796
Primers used for PCR NB61 - 8474, show primer details
   
Sequence Name 17-K034548-022-737-D05C-8409
GenBank Accession LN493761 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K034548-022-737-D05C-8409
TGAGCCATTTACAATTGAATATATAAGACAATATAAGACAACATATGTTGTCCACAACCT
TAAGTTTCATTTTTTGTGTTACAATCTTTATAAATTTGAGACGAAATTATTTTCTCCTAT
AGTCTTCATCGCAAAAATAAACAGTTAAGAAAGCTTTCTTTTCACTTTCTCCAATGGCTT
ATTCTAAAGCATGTTATAAACTCACCACCATTACAATTCTTCTTCTATCCTTCACATTAC
CCTCTCTTGCCGGTAACGCTGAAAACGCAGATGTAAGTGAATGCAAAGCTGAATCTGGAG
ATCTATCATGTCACAACAACAAAGAAGCACAAAAGCTTAAAATCATTGCAATCCCATCTA
TCTTAGTGGCGAGCAT
   
Sequence Name 18-K034548-022-737-D05C-NB61
GenBank Accession LN494210 [GenBank]
Sequencing primer gene specific primer, NB61: 5'-ATCATGCTCGCCACTAAGATAGAT-3'
Sequence (A. th genome BLAST matches underlined)
>18-K034548-022-737-D05C-NB61
TGTGCTTCTTTGTTGTTGTGACATGATAGATCTCCAGATTCAGCTTTGCATTCACTTACA
TCTGCGTTTTCAGCGTTACCGGCAAGAGAGGGTAATGTGAAGGATAGAAGAAGAATTGTA
ATGGTGGTGAGTTTATAACATGCTTTAGAATAAGCCATTGGAGAAAGTGAAAAGAAAGCT
TTCTTAACTGTTTATTTTTGCGATGAAGACTATAGGAGAAAATAATTTCGTCTCAAATTT
ATAAAGATTGTAACACAAAAAATGAAACTTAAGGTTGTGGACAACATATGTTGTCTTATA
TTGTCTTATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
TTATTTCGACGTGTCTACATTCACTCCACAATGGG

Last Updated on 07.07.2016 14:16