SimpleSearch - Line and FST details


Line specific information

 
Line ID 737D05
Vector Used pGABI1
Line Availability only available from NASC (N470697)
Segregation Analysis 12:10:9
Confirmed for Hit At2g04032
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g04032

 
Sequence (A. th genome BLAST matches underlined)
>36-K023553-022-737-D05-8409
AATTGAATATATCATGTAGAGTATGGGATCCTCCCTATAGTGAGACATTAGGTTAATTTT
TTGAGATAGAGTCTTTATAAATTTGAGACGAAATTATTTTCTCCTATAGTCTTCATCGCA
AAAATAAACAGTTAAGAAAGCTTTCTTTTCACTTTCTCCAATGGCTTATTCTAAAGCATG
TTATAAACTCACCACCATTACAATTCTTCTTCTATCCTTCACATTACCCTCTCTTGCCGG
TAACGCTGAAAACGCAGATGTAAGTGAATGCAAAGCTGAATCTGGAGATCTATCATGTCA
CAACAACAAAGAAGCACAAAAGCTTAAAATCATTGCAATCCCATCTATCTTAGTGGCGAG
CATGATCGGTGTTTCTTTACCGTTGATTTCGCGTTCCATTCCTGCTTTAGGACCCGATCG
AAAAATGACTGTGATCG
GenBank Accession BX895083 [GenBank]
Graphic View Graphic view of gene At2g04032
Predicted Position of Insertion Chr2:1289811 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3C11
Hit Gene Code At2g04032 [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc transporter 7 precursor
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23