Sequences from confirmation amplicon


Confirmation sequences for line 740E11 and hit At4g25100 are shown.
Line ID 740E11
Locus At4g25100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:12886384
Primers used for PCR NR56 - 8474, show primer details
   
Sequence Name 85-K102508-0022-740-E11C-8409
GenBank Accession LN514532 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102508-0022-740-E11C-8409
TGATCCAACGAAAACAAAATGACATTTGCCGACAATATCAATCTTTATCATAAGAAAGTA
CCAGTGCGAATGGAGGTGGCTTGAGGACGTAGTTTGCGGTGACAGCACTTGAAGCAGCCA
TTCTTTGTAATTGAAGCTGCACATTTCAGACAAAACATAGCATTGAATTGATTATCTATT
TGCCCAAAAAAATGAATCAATATCCTTACAAAGACACATGAAAATGTATACATGCGTTTA
TGTTGTTGGGAGACCAAACAAATTTCTAGGTGAAAGAGTAAGAGACCAGAGAAACTCGAA
CATGAACTAAGATGTGGATGAGAGATAGAATCAGTACCTCAAGTTTCAAGGACGAGTGAA
GTGAGGAGAGCACACGCCAGTGGAATCTGTGTGTTTTGAGTTTTATGGTTGGATGGCTCT
GCTTTTTGGTAATCGAGTTGTGTCGTACATGTGGCAGTACGACGTATCATTTTGTACTAT
CATTATCTTTTTGTAGTACATTTTTTTTTTCTGGCTTCGTGGCTACTATTGACTCATTGT
GATTTGTGTCATCATAAATTGTCTTGAAACTTAATAACATTTGAGTCATCATAAGTGGAT
CACCAATGAGTA
   
Sequence Name 85-K102509-0022-740-E11C-NR56
GenBank Accession LN514533 [GenBank]
Sequencing primer gene specific primer, NR56: 5'-GCTGATCCACTTATGATGACTCAA-3'
Sequence (A. th genome BLAST matches underlined)
>85-K102509-0022-740-E11C-NR56
ATCACAATGAGTCAATAGTAGCCACGAAGCCAGAAAAAAAAAATGTACTACAAAAAGATA
ATGATAGTACAAAATGATACGTCGTACTGCCACATGTACGACACAACTCGATTACCAAAA
AGCAAAGCCATCCAACCATAAAACTCAAAACACACAGATTCCACTGGCGTGTGCTCTCCT
CACTTCACTCGTCCTTGAAACTTGAGGTACTGATTCTATCTCTCATCCACATCTTAGTTC
ATGTTCGAGTTTCTCTGGTCTCTTACTCTTTCACCTAGAAATTTGTTTGGTCTCCCAACA
ACATAAACGCAGGTATACATTTTCATGTGTCTTTGTAAGGATATTGATTCATTTTTTTGG
GCAAATAGATAATCAATTCAATGCTATGTTTTGTCTGAAATGTGCAGCTTCAATTACAAA
GAATGGCTGCTTCAAGTGCTGTCACCGCAAACTACGTCCTCAAGCCACCTCCATTCGCAC
TGGTACTTTCTTATGATAAAGATTGATATTGTCGGCAAATGTCATTTTGTTTTCGTTGGA
TCAGCAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACNAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTAT

Last Updated on 23.10.2014 13:25