SimpleSearch - Line and FST details


Line specific information

 
Line ID 740E11
Vector Used pAC161
Line Availability only available from NASC (N471003)
Segregation Analysis 50:47:37
Confirmed for Hit At4g25100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g25100

 
Sequence (A. th genome BLAST matches underlined)
>85-K024549-022-740-E11-8409
CTGATCCAACAAAAACAAAATGACATTTGCCGACAATATCAATCTTTATCATAAAAAAGT
ACCAGTGCGAATGGAGGTGGCTTGAGGACGTACTTTGCGGTGACAACACTTGAAGCAGCC
ATTCTTTGTAATTGAAGCTGCACATTTCAAACAAAACATAGCATTGAATTGATTATCTAT
TTGCCCAAAAAAATGAATCAATATCCTTACAAAGACACATGAAAATGTATACATGCGTTT
ATGTTGTTGGGAGACCAAACAAATTTCTATGGGATCCTCCCTATAGTGAGACNAANGACT
CCCTTNCATACACGAACAAAGAGAAACAAG
GenBank Accession BX945785 [GenBank]
Graphic View Graphic view of gene At4g25100
Predicted Position of Insertion Chr4:12886384 - go to primer design
BLAST e Value 1e-123
Hit Clone Code (BAC ID) F13M23
Hit Gene Code At4g25100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Fe superoxide dismutase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03