Sequences from confirmation amplicon


Confirmation sequences for line 745G01 and hit At3g62530 are shown.
Line ID 745G01
Locus At3g62530 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:23132703
Primers used for PCR MA62 - 8474, show primer details
   
Sequence Name 75-K102435-0022-745-G01C-8409
GenBank Accession LN513217 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>75-K102435-0022-745-G01C-8409
TCGGACTGAGCCTTTACAATCAAATTTTTATGTATATATTGATGACTTTGAGTTTGTCTC
ATTGTTCTCTAACTCAAAATGCATTTTGTTTTTGCTTCTTCTTAGGCTGCATTTGTGTTG
GGACAATTGGAATCCAAAACAGCTATAGCTTCTCTAAGCAAGATCTTGAGAGATGTGAAG
GAGCACCCCATGGTTCGAGTAGAGGCTGCAAAAGCCCTTGGTTTCATTGCAGGTATATTC
CTAGAAGCTACCACAATTTTGTGTCTTTAATTAATTACTCTTTGACATTCTTTGGGTTTT
TTTTCAGATGAGAAGAGCAGAGAAGTACTCCAAGAACTTTCAGGCGACCTCGATCCCATT
ATCGCTAAAGGTTGTGATTCTTCATTGAGTATCTTGGAATTTAAGAATTCAAAAAAATAT
GACCCTCTCATATAAAATGGGNTGTGTGGG
   
Sequence Name 75-K102436-0022-745-G01C-MA62
GenBank Accession LN513218 [GenBank]
Sequencing primer gene specific primer, MA62: 5'-CCCACACACACCATTTTATATGAG-3'
Sequence (A. th genome BLAST matches underlined)
>75-K102436-0022-745-G01C-MA62
TTTTGATTTTAATTCAGATACTCAATGAAGAATCCAACCTTTAGCGATAATGGGATCGAG
GTCGCCTGAAAGTTCTTGGAGTACTTCTCTGCTCTTCTCATCTGAAAAAAAACCCAAAGA
ATGTCAAAGAGTAATTAATTAAAGACACAAAATTGTGGTAGCTTCTAGGAATATACCTGC
AATGAAACCAAGGGCTTTTGCAGCCTCTACTCGAACCATGGGGTGCTCCTTCACATCTCT
CAAGATCTTGCTTAGAGAAGCTATAGCTGTTTTGGATTCCAATTGTCCCAACACAAATGC
AGCCTAAGAAGAAGCAAAAACAAAATGCATTTTGAGTTAGAGAACAATGAGACAAACTCA
AAGTCATCAATATATACATAAAAATTTGATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGA
TAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTA
ATTCGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 07.07.2016 14:16