SimpleSearch - Line and FST details


Line specific information

 
Line ID 745G01
Vector Used pAC161
Line Availability only available from NASC (N471497)
Segregation Analysis 50:40:25
Confirmed for Hit At3g62530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g62530

 
Sequence (A. th genome BLAST matches underlined)
>07-K023903-022-745-G01-8409
TAATATAGCATAGAACGTCTGCAACACCTATGGGATCCTCCCTATAGTGAGTCGTATTAC
ACTTTGTTTTTGCCTCATCTTAGGCTGCATTTGTGTTGGGACAATTGGAATCCAAAACAG
CTATAGCTTCTCTAAGCAAGATCTTGAGAGATGTGAAGGAGCACCCCATGGTTCGAGTAG
AGGCTGCAAAAGCCCTTGGTTTCATTGCAGGTAAATTCCTATGGGATCCTCCCTATAATG
AGTCGGAAAACAAAATATAAATTCTGAGATCATGCCGGTGCACCCGGGAAGCGGAAGATC
ACCCATTTCATCTTCAGATTGGTCTGAGATTATGCGAAAATATACACTCATATACATAAA
TACTGACAGTTTGAGCTACCAATTCAGTGTAACCCAAAAAACTAAAGATCCCCCTGACTC
CATAATGCCCGAATCGCGAATCCATCGAGTACACCGGAGGACAAGGCATAGAGGACCACT
TGAAAAGATACCCATTTCATCTTCAGATTGGTCGGAGATTATG
GenBank Accession BX895684 [GenBank]
Graphic View Graphic view of gene At3g62530
Predicted Position of Insertion Chr3:23132724 - go to primer design
BLAST e Value 9e-78
Hit Clone Code (BAC ID) T12C14
Hit Gene Code At3g62530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03